ntcre/loxp deletion system controlled by heat shock and tetracycline, recombinant expression vector, and preparation method and application of recombinant expression vector

An expression vector and tetracycline technology, applied in the field of genetic engineering, can solve the problems of heat shock promoter leakage, unsatisfactory control gene deletion system, and high application environment requirements, achieving short deletion cycle, overcoming unexpected temperature rise, and simple preparation method Effect

Inactive Publication Date: 2012-07-04
SOUTHWEST UNIVERSITY
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The Arabidopsis heat shock promoter HSP18.2 can control the expression of downstream genes by controlling the temperature, but most heat shock promoters have leakage problems and have high requirements for the application environment, so it is not ideal for controlling gene deletion systems

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • ntcre/loxp deletion system controlled by heat shock and tetracycline, recombinant expression vector, and preparation method and application of recombinant expression vector
  • ntcre/loxp deletion system controlled by heat shock and tetracycline, recombinant expression vector, and preparation method and application of recombinant expression vector
  • ntcre/loxp deletion system controlled by heat shock and tetracycline, recombinant expression vector, and preparation method and application of recombinant expression vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1, construction of heat shock promoter HSP70m

[0042] According to the reported Arabidopsis thaliana heat shock protein gene AtHSP70b (GenBank accession number AC010924), the promoter sequence of the AtHsp70b gene was analyzed, and the analysis found that there were two structural problems in AtHsp70b: (1) There was a Auxin response element (AuxRE), the sequence is TGTCTC, and there is also a core sequence ACGT of abscisic acid (ABA) response element (ABRE), so after AtHsp70b::GUS is introduced into tobacco, there is expression leakage at room temperature; (2) There is a heat shock element (HSF) in AtHsp70b, but the structure of the heat shock element is imperfect. Therefore, the AtHSP70b gene was improved to construct two standard heat shock elements (HSE), with a 59bp sequence between the two HSEs, and the AuxRE element and ABRE element on the AtHSP70b were removed, and the structurally imperfect heat The activation element was transformed into HSE with nnGA...

Embodiment 2

[0046] Embodiment 2, construction HSF70m promoter regulates the expression box of Rhsf gene

[0047] According to the reported tetracycline repressor protein gene (TetR) sequence (GenBank accession No. J01830), design primers, the upstream primer is 5'- cctag aattaatgatgtctagattag-3' (SEQ ID NO.4), the underline is the endonuclease Avr II recognition site, and the downstream primer is: 5'- ggatcc actttcacatttaagttg-3' (SEQ ID NO.5), the underlined part is the recognition site of the endonuclease BamH I, using Escherichia coli XL1-blue as a template, PCR amplification was carried out with high fidelity, and the PCR reaction conditions were: 98°C pre- Denaturation for 1 minute; denaturation at 98°C for 10 seconds, annealing at 50°C for 15 seconds, extension at 72°C for 1 minute, 3 cycles; denaturation at 98°C for 10 seconds, annealing at 55°C for 15 seconds, extension at 72°C for 1 minute, 27 cycles, 72°C Extend for 10 minutes. The PCR product was subjected to agarose gel el...

Embodiment 3

[0051] Embodiment 3, establishment of heat shock and tetracycline dual regulation system

[0052] Digest the gained pVCT2027 vector with Sal I and Xba I, agarose gel electrophoresis, abandon the HSF70m promoter, reclaim the pVCT2027 vector backbone of 4820bp; TetO2-TetO1), replace the two HSE standard heat shock elements of the HSF70m promoter with TetO2-TetO1, and then connect with the 35S micro-promoter to form the Om35S promoter, the sequence is 5'-ag gtcgac gattcccggtcggt ttgtacctttgcgcgattactccacctttgcacaatcccctgggttgtgccacgacctttt tgcatgacccttcctctatataaggaagttcatttcatttggagagaacacgggggac tctaga gg-3' (SEQ ID NO.8) is the Sal I and Xba I sites with a single line, the tetracycline operator sequence is a double line, and tatata is a TATA box. The double-stranded nucleotides of the Om35S promoter shown in (SEQ ID NO.8) were artificially synthesized, and double-digested with Sal I and Xba I, and the Om35S promoter was recovered, and the recovered Om35S promoter was co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an ntCre / LoxP deletion system controlled by heat shock and tetracycline. The ntCre / LoxP deletion system comprises 2 LoxP loci specifically identified by ntCre recombinase and a target gene part positioned between the 2 LoxP loci, wherein the 2 LoxP loci are respectively a first LoxP locus positioned at the 3' end of target gene and a second LoxP locus positioned at the 5' end of the target gene; and the ntCre / LoxP deletion system also comprises an Rhsf gene expression box controlled by an HSF70m promoter and an ntCre recombinase gene expression box part controlled by an Om35S promoter, wherein the Om35S promoter is controlled by Rhsf gene. The deletion system is controlled by the heat shock and the tetracycline, and the target gene between the 2 LoxP loci can be deleted through heat shock under the condition of no tetracycline. The invention also discloses a recombinant expression vector containing the ntCre / LoxP deletion system. The recombinant expression vector can be applied to deleting target genes in plant transgenes, and has the advantages of short deletion period, simple operation and the like.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to an ntCre / LoxP deletion system regulated by heat shock and tetracycline and its application, and also to a recombinant expression vector containing the ntCre / LoxP deletion system and its preparation method and application. Background technique [0002] In obtaining a transgene, it is often necessary to transfer the target gene. At the same time, in order to separate the transgenic cells from the non-transgenic cells, it is also necessary to introduce a selection marker gene, which is generally a resistance gene. On the one hand, the introduced resistance genes will cause genetic pollution due to gene drift, such as the formation of super weeds; Genes, especially resistance genes, have become a hotspot in the research of transgenic plants. [0003] At present, gene deletion systems are mainly used to delete target genes in transgenic plants, mainly including site-specific recomb...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/11C12N15/63C12N15/66A01H5/00
Inventor张兴国苏承刚杜小兵朱利泉眭顺照张香琴
OwnerSOUTHWEST UNIVERSITY