ntcre/loxp deletion system controlled by heat shock and tetracycline, recombinant expression vector, and preparation method and application of recombinant expression vector
An expression vector and tetracycline technology, applied in the field of genetic engineering, can solve the problems of heat shock promoter leakage, unsatisfactory control gene deletion system, and high application environment requirements, achieving short deletion cycle, overcoming unexpected temperature rise, and simple preparation method Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1, construction of heat shock promoter HSP70m
[0042] According to the reported Arabidopsis thaliana heat shock protein gene AtHSP70b (GenBank accession number AC010924), the promoter sequence of the AtHsp70b gene was analyzed, and the analysis found that there were two structural problems in AtHsp70b: (1) There was a Auxin response element (AuxRE), the sequence is TGTCTC, and there is also a core sequence ACGT of abscisic acid (ABA) response element (ABRE), so after AtHsp70b::GUS is introduced into tobacco, there is expression leakage at room temperature; (2) There is a heat shock element (HSF) in AtHsp70b, but the structure of the heat shock element is imperfect. Therefore, the AtHSP70b gene was improved to construct two standard heat shock elements (HSE), with a 59bp sequence between the two HSEs, and the AuxRE element and ABRE element on the AtHSP70b were removed, and the structurally imperfect heat The activation element was transformed into HSE with nnGA...
Embodiment 2
[0046] Embodiment 2, construction HSF70m promoter regulates the expression box of Rhsf gene
[0047] According to the reported tetracycline repressor protein gene (TetR) sequence (GenBank accession No. J01830), design primers, the upstream primer is 5'- cctag aattaatgatgtctagattag-3' (SEQ ID NO.4), the underline is the endonuclease Avr II recognition site, and the downstream primer is: 5'- ggatcc actttcacatttaagttg-3' (SEQ ID NO.5), the underlined part is the recognition site of the endonuclease BamH I, using Escherichia coli XL1-blue as a template, PCR amplification was carried out with high fidelity, and the PCR reaction conditions were: 98°C pre- Denaturation for 1 minute; denaturation at 98°C for 10 seconds, annealing at 50°C for 15 seconds, extension at 72°C for 1 minute, 3 cycles; denaturation at 98°C for 10 seconds, annealing at 55°C for 15 seconds, extension at 72°C for 1 minute, 27 cycles, 72°C Extend for 10 minutes. The PCR product was subjected to agarose gel el...
Embodiment 3
[0051] Embodiment 3, establishment of heat shock and tetracycline dual regulation system
[0052] Digest the gained pVCT2027 vector with Sal I and Xba I, agarose gel electrophoresis, abandon the HSF70m promoter, reclaim the pVCT2027 vector backbone of 4820bp; TetO2-TetO1), replace the two HSE standard heat shock elements of the HSF70m promoter with TetO2-TetO1, and then connect with the 35S micro-promoter to form the Om35S promoter, the sequence is 5'-ag gtcgac gattcccggtcggt ttgtacctttgcgcgattactccacctttgcacaatcccctgggttgtgccacgacctttt tgcatgacccttcctctatataaggaagttcatttcatttggagagaacacgggggac tctaga gg-3' (SEQ ID NO.8) is the Sal I and Xba I sites with a single line, the tetracycline operator sequence is a double line, and tatata is a TATA box. The double-stranded nucleotides of the Om35S promoter shown in (SEQ ID NO.8) were artificially synthesized, and double-digested with Sal I and Xba I, and the Om35S promoter was recovered, and the recovered Om35S promoter was co...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap