High-sensitivity real-time fluorescence detection method
A technology for detecting samples and target nucleic acids, applied in the field of nucleic acid detection, can solve the problems of lower detection value, lower fluorescence ΔR value, lower detection sensitivity, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] The detection of embodiment 1 DNA sequence
[0040] We designed primers and probes for the HBV S gene sequence, and entrusted Beijing Liuhetong Economic and Trade Co., Ltd. to synthesize the following PCR amplification primers and probes (including control probes) to contain HBV (hepatitis B virus nucleic acid (HBV DNA) ) Qualitative and quantitative national reference material, No. 300009, can be purchased from China National Institutes for Food and Drug Control according to regulations, diluted with purified water) 1 × 10 2 IU / ml (positive), 20IU / ml (sensitivity 1) and 10IU / ml (sensitivity 2) aqueous solution or pure water (negative) are respectively used as templates, and are carried out on ABI 7500 fluorescent PCR instrument (available from Applied Biosystems company) PCR detection:
[0041] Forward primer: CGAGGCAGGTCCCCTAGAA
[0042] Reverse primer: CGGCGATTGAGACCTTCGT
[0043] The probe (control probe 1) used in the traditional Taqman-specific method: FAM-AGAA...
Embodiment 2
[0052] The detection of embodiment 2RNA sequence
[0053] We designed primers and probes for the HCV NS2 gene, and commissioned Beijing Liuhetong Economic and Trade Co., Ltd. to synthesize the following PCR amplification primers and probes (including control probes) to contain HCV (the second-generation HCV RNA national reference product, No. 300012, can be purchased from China National Institutes for Food and Drug Control according to regulations, diluted with purified water) 5 × 10 2 IU / ml (positive), 2.5×10 2 IU / ml (sensitivity 1) and 1×10 2 The aqueous solution (positive) or water (negative) of IU / ml (sensitivity 2) is respectively used as template, carries out RT-PCR detection on ABI 7500 fluorescent PCR instrument (available from Applied Biosystems company):
[0054] Forward primer: TCGCCATATTACAAGCGCTACA
[0055] Reverse primer: GCGCTTCTACTCTGGTCAGAAAA
[0056] The specific probe (control probe 1) used in the traditional Taqman method: FAM-CATGTGGTGGCTTCA-ECLIPSE, t...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap