High-sensitivity real-time fluorescence detection kit and application thereof
A technology for detection kits and kits, applied in the field of nucleic acid detection,
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] We designed primers and probes for the HBV S gene sequence, and entrusted Beijing Liuhetong Economic and Trade Co., Ltd. to synthesize the following PCR amplification primers and probes (including control probes) to contain HBV (hepatitis B virus nucleic acid (HBV DNA) ) Qualitative and quantitative national reference material, No. 300009, can be purchased from China National Institutes for Food and Drug Control according to regulations, diluted with purified water) 1 × 10 2 The aqueous solution or pure water (negative) of IU / ml (positive), 20IU / ml (sensitivity 1) and 10IU / ml (sensitivity 2) is respectively used as template, carries out on ABI 7500 fluorescent PCR instrument (available from Applied Biosystems company) PCR detection:
[0041] Forward primer: CGAGGCAGGTCCCCTAGAA
[0042] Reverse primer: CGGCGATTGAGACCTTCGT
[0043] The probe (control probe 1) used in the traditional Taqman-specific method: FAM-AGAACTCCCTCGCCTCG-ECLIPSE, the 5' end of the nucleic acid is...
Embodiment 2
[0053] We designed primers and probes for the HCV NS2 gene, and commissioned Beijing Liuhetong Economic and Trade Co., Ltd. to synthesize the following PCR amplification primers and probes (including control probes) to contain HCV (the second-generation HCV RNA national reference product, No. 300012, can be purchased from China National Institutes for Food and Drug Control according to regulations, diluted with purified water) 5 × 10 2 IU / ml (positive), 2.5×10 2 IU / ml (sensitivity 1) and 1×10 2 The aqueous solution (positive) or water (negative) of IU / ml (sensitivity 2) is respectively used as template, carries out RT-PCR detection on ABI 7500 fluorescent PCR instrument (available from Applied Biosystems company):
[0054] Forward primer: TCGCCATATTACAAGCGCTACA
[0055] Reverse primer: GCGCTTCTACTCTGGTCAGAAAA
[0056] The specific probe (control probe 1) used in the traditional Taqman method: FAM-CATGTGGTGGCTTCA-ECLIPSE, the 5' end of the nucleic acid is marked with the flu...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com