Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Agrobacterium strain carrying Yunnan tomato leaf curl virus infectious clones and application thereof

A leaf virus and tomato koji technology is applied in the field of Agrobacterium strains carrying infectious clones of Yunnan tomato leaf curl virus, which can solve problems such as damage and crop production loss, and achieve the effects of good repeatability and simple operation.

Inactive Publication Date: 2012-09-26
ZHEJIANG UNIV
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] Since the 1990s, with global warming and the increase of international trade, the area where whitefly exists has expanded unprecedentedly, and the geminivirus transmitted by whitefly is also worldwide (Africa, the Mediterranean Basin, East Asia, South Asia , Central and North America and the Caribbean, etc.) and has caused serious damage to many important crops (tomato, cassava and cotton, etc.), causing serious losses to crop production
Although this technology was developed relatively late, its development is extremely rapid, especially for viruses that cannot be transmitted mechanically. The construction of its infectious clones provides the possibility for further research on the structure, function and expression regulation mechanism of viral genomes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Agrobacterium strain carrying Yunnan tomato leaf curl virus infectious clones and application thereof
  • Agrobacterium strain carrying Yunnan tomato leaf curl virus infectious clones and application thereof
  • Agrobacterium strain carrying Yunnan tomato leaf curl virus infectious clones and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1. Construction of Yunnan Tomato Leaf Curl Virus Infectious Clones

[0020] Agrobacterium-mediated invasive cloning of geminiviruses requires a full-length genome with more than 1.3-2.0 repeats and must include 2 intergenic regions (IR regions). Using Yunnan tomato leaf curl virus genome DNA as a template to contain Eco Y194EF (5'- GCGGAATTCCTTAAAGTGCTTTAG -3') and Y194ER (5'- TAGGAATTCATGGGAGCCCAAAG -3') at the R I single restriction site were used as primers, amplified by PCR and cloned into pGEM-T Vector to obtain pGEM-T-Y194, using Bam H I and Eco R I digested pGEM-T-Y194 to obtain 0.4 full-length DNA for insertion Bam H I and Eco The binary vector pBinPLUS obtained by R I double enzyme digestion was pBinPLUS-Y194-0.4A; Eco R I cut out a complete full-length DNA from pGEM-T-Y194 and inserted it into the corresponding site of pBinPLUS-Y194-0.4A to obtain an invasive clone of pBinPLUS-Y194-1.4A.

Embodiment 2

[0021] Embodiment 2. Transformation of Agrobacterium by electric shock with pBinPLUS-Y194-1.4A recombinant vector

[0022] The recombinant plant expression vector was introduced into the Agrobacterium host cell EHA105 by electric shock. First, the competent cells of EHA105 need to be prepared. Pick a single colony of Agrobacterium tumefaciens EHA105 and inoculate it in 5 mL of YEP liquid medium containing 40 μg / mL rifampicin (Rif), culture at 28°C and 200 rpm until OD600≈0.6, and collect enough Bacteria were centrifuged at 8,000 rpm at 4°C for 1 min, and the supernatant was discarded; the cells were washed with 200 μL ddH 2 Sufficiently resuspend O, centrifuge at 8,000 rpm at 4°C for 1 min, and discard the supernatant; repeat step 3 three times, discard the supernatant; finally, the cells are washed with 200 μL ddH 2 O Sufficiently resuspend, namely Agrobacterium tumefaciens competent cells. Take 10 μL of the recombinant plasmid pBinPLUS-Y194-1.4A and add it to 200 μL of A...

Embodiment 3

[0023] Embodiment 3. Agrobacterium prickly grafted plant carrying Yunnan tomato leaf curl virus infectious clone

[0024] pBinPLUS-Y194-1.4A was cultured on YEP solid plate medium containing 100 μg / mL kanamycin and 40 μg / mL rifampicin at 28°C for 48 hours. It is advisable to use fully expanded seedlings at the 4-6 leaf stage for the inoculated plants. Inoculate Ben's tobacco, tomato, heart leaf tobacco, Sansheng tobacco, and ordinary tobacco. The specific inoculation method is as follows, take a sterilized toothpick, pick solid colonies, take three points 1-2cm away from the root for phloem prick inoculation, and place the inoculated plants in an isolated greenhouse at 25°C for cultivation.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a agrobacterium strain carrying Yunnan tomato leaf curl virus infectious clones and application thereof. 1.4 forward repetitive Yunnan tomato leaf curl virus full-length genomes of DNAs (deoxyribonucleic acids) are constructed to an efficient plant expression vector pBinPLUS by a molecular biology method, and an agrobacterium strain EHA105 is introduced by an electric shock method to obtain a virus infectious clone agrobacterium strain ToLCYnV-Y194 capable of efficiently infecting plants, wherein the collection number of the agrobacterium strain is CGMCC No.5931. The strain can generate massive Yunnan tomato leaf curl virus infectious clone which can efficiently infect multiple host plants, and provides technical and material supports for pathogenicity analysis and genome function research of Yunnan tomato leaf curl virus as well as tomato breeding for disease resistance.

Description

technical field [0001] The field of the invention belongs to the field of genetic engineering, and in particular relates to an agrobacterium strain carrying Yunnan tomato leaf curl virus invasive clone and application thereof. Background technique [0002] Since the 1990s, with global warming and the increase of international trade, the area where whitefly exists has expanded unprecedentedly, and the geminivirus transmitted by whitefly is also worldwide (Africa, the Mediterranean Basin, East Asia, South Asia , Central and North America, and the Caribbean, etc.) and has caused serious damage to many important crops (tomato, cassava, and cotton, etc.), causing serious losses to crop production. Crops such as tomato, cassava, cotton and tobacco have been devastated by this virus in more than 40 countries. More than 40 species have been found in crops such as tobacco, tomato, papaya and pumpkin, as well as weeds such as false horsewhip, red thistle and dilute alkali in 17 provi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/84A01G7/00C12Q1/70C12Q1/68C12R1/01
Inventor 谢艳周雪平赵丽玲吴建祥
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com