Agrobacterium strain carrying Yunnan tomato leaf curl virus infectious clones and application thereof
A leaf virus and tomato koji technology is applied in the field of Agrobacterium strains carrying infectious clones of Yunnan tomato leaf curl virus, which can solve problems such as damage and crop production loss, and achieve the effects of good repeatability and simple operation.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Example 1. Construction of Yunnan Tomato Leaf Curl Virus Infectious Clones
[0020] Agrobacterium-mediated invasive cloning of geminiviruses requires a full-length genome with more than 1.3-2.0 repeats and must include 2 intergenic regions (IR regions). Using Yunnan tomato leaf curl virus genome DNA as a template to contain Eco Y194EF (5'- GCGGAATTCCTTAAAGTGCTTTAG -3') and Y194ER (5'- TAGGAATTCATGGGAGCCCAAAG -3') at the R I single restriction site were used as primers, amplified by PCR and cloned into pGEM-T Vector to obtain pGEM-T-Y194, using Bam H I and Eco R I digested pGEM-T-Y194 to obtain 0.4 full-length DNA for insertion Bam H I and Eco The binary vector pBinPLUS obtained by R I double enzyme digestion was pBinPLUS-Y194-0.4A; Eco R I cut out a complete full-length DNA from pGEM-T-Y194 and inserted it into the corresponding site of pBinPLUS-Y194-0.4A to obtain an invasive clone of pBinPLUS-Y194-1.4A.
Embodiment 2
[0021] Embodiment 2. Transformation of Agrobacterium by electric shock with pBinPLUS-Y194-1.4A recombinant vector
[0022] The recombinant plant expression vector was introduced into the Agrobacterium host cell EHA105 by electric shock. First, the competent cells of EHA105 need to be prepared. Pick a single colony of Agrobacterium tumefaciens EHA105 and inoculate it in 5 mL of YEP liquid medium containing 40 μg / mL rifampicin (Rif), culture at 28°C and 200 rpm until OD600≈0.6, and collect enough Bacteria were centrifuged at 8,000 rpm at 4°C for 1 min, and the supernatant was discarded; the cells were washed with 200 μL ddH 2 Sufficiently resuspend O, centrifuge at 8,000 rpm at 4°C for 1 min, and discard the supernatant; repeat step 3 three times, discard the supernatant; finally, the cells are washed with 200 μL ddH 2 O Sufficiently resuspend, namely Agrobacterium tumefaciens competent cells. Take 10 μL of the recombinant plasmid pBinPLUS-Y194-1.4A and add it to 200 μL of A...
Embodiment 3
[0023] Embodiment 3. Agrobacterium prickly grafted plant carrying Yunnan tomato leaf curl virus infectious clone
[0024] pBinPLUS-Y194-1.4A was cultured on YEP solid plate medium containing 100 μg / mL kanamycin and 40 μg / mL rifampicin at 28°C for 48 hours. It is advisable to use fully expanded seedlings at the 4-6 leaf stage for the inoculated plants. Inoculate Ben's tobacco, tomato, heart leaf tobacco, Sansheng tobacco, and ordinary tobacco. The specific inoculation method is as follows, take a sterilized toothpick, pick solid colonies, take three points 1-2cm away from the root for phloem prick inoculation, and place the inoculated plants in an isolated greenhouse at 25°C for cultivation.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap