Unlock instant, AI-driven research and patent intelligence for your innovation.

Mycobacterium tuberculosis recombinant protein and preparation method thereof

A technology of mycobacterium tuberculosis and protein, which is applied in the fields of genetic engineering technology, diagnostic reagents and vaccine development, can solve the problems of unsatisfactory sensitivity and achieve high sensitivity and strong specificity

Inactive Publication Date: 2012-10-31
THE 309TH HOSPITAL OF CHINESE PEOPLES LIBERATION ARMY
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the sensitivity of single antigen detection is often not as good as expected

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mycobacterium tuberculosis recombinant protein and preparation method thereof
  • Mycobacterium tuberculosis recombinant protein and preparation method thereof
  • Mycobacterium tuberculosis recombinant protein and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1 Preparation of tuberculosis recombinant protein

[0051] 1.1 Tuberculosis protein epitope screening and target gene cloning

[0052] The complete genome sequence of TB H37RV was analyzed by computer, and the DNA sequences of its strong epitope ricR protein (GenBank: GU726749.1), rpoB (GenBank: GQ395623.1) and GyrB (GenBank: AJ564417.1) were selected as templates, and the amplification was designed. The primers are:

[0053] ricR amplification primers:

[0054] F1: ATCGCATATG ATGACAGCAGCACACGGCTACACGCAGCA

[0055] 53.85% Tm=66.34

[0056] R1: AATCGCGCGCCTGGTTCGTTCCGGTGGTGGTGGTTGTTCTCGA

[0057] 60.47% Tm=67.79

[0058] rpoB amplification primers:

[0059] F2: GGTGGTGGTGGTTGTTCTCGACCGCGCTT

[0060] 62.07% Tm=61.06

[0061] R2::AGTCACCACCACCACCTCGCGGTTGTTCTGGATCAAA

[0062] 54.05%, Tm=65.51

[0063] GyrB amplification primers:

[0064] F3: GGTGGTGGTGGTGACTCGGCCGGCGGTTCTGCAAAAA

[0065] 62.16% Tm=65.54

[0066] R3: ATCGCTCGAGGTTCTTTAGCACCCGGTCGAT

[...

Embodiment 2

[0092] Example 2 Establishment of enzyme-linked immunoassay (ELISA) detection of Mycobacterium tuberculosis antibody IgG

[0093] The detection of Mycobacterium tuberculosis antibody IgG by indirect ELISA method can be used for identification of TB antigen activity and auxiliary diagnosis of TB infection. In this example, the Mycobacterium tuberculosis recombinant fusion protein prepared in Example 1 was used as the antigen; in order to determine the antigen coating amount and the working concentration of the enzyme-labeled secondary antibody, positive and negative reference materials were used as test samples, and the matrix titration method was used to select The optimal antigen coating amount and the corresponding enzyme-labeled secondary antibody working concentration are shown in Table 3 below.

[0094] Table 3 Selection of optimal antigen coating amount and corresponding enzyme-labeled secondary antibody working concentration

[0095]

[0096] According to the test res...

Embodiment 3

[0097] Example 3 Performance Verification of Mycobacterium tuberculosis IgG Antibody Detection Kit (Enzyme-linked Immunoassay)

[0098] The recombinant TB protein prepared in Example 1 was coated on a microwell plate, and the TB IgG antibody was determined by ELISA.

[0099] 3.1 The principle and components of the kit are as follows:

[0100] 1) The principle of the kit: This strain uses a microwell plate coated with genetically engineered recombinant TB antigen, horseradish peroxidase (HRP) labeled anti-human IgG as a tracer, TMB chromogenic system, and the principle of indirect method for detection Anti-TB IgG antibodies in human serum or plasma.

[0101] 2) The main components of the kit:

[0102] Pre-coated plate, enzyme conjugate, negative control, positive control, concentrated washing solution (20×), substrate solution A, substrate solution B, stop solution.

[0103] 3.2 Kit performance test

[0104] Determination of specificity: According to the indirect ELISA assa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides mycobacterium tuberculosis recombinant protein and a preparation method thereof and relates to the field of genetic engineering technologies and development of diagnostic reagents and vaccines. The invention relates to mycobacterium tuberculosis fusion protein which is used for the mycobacterium tuberculosis clinical diagnosis, a nucleotide sequence of the protein is coded and comprises plasmids of the nucleotide sequence and a pronucleus host cell. The invention also comprises a method for preparing the protein and the application of the protein. The protein has the protein sequence which is high in specificity and high in immunogenicity, so that the sensibility and the specificity can be improved; a recombinant protein technology in which a plurality of antigenic determinants are in series connection, so that the purification process is simplified and the working efficiency is improved.

Description

technical field [0001] The invention relates to the fields of genetic engineering technology, diagnostic reagents and vaccine development, in particular to a Mycobacterium tuberculosis recombinant protein and a preparation method thereof. Background technique [0002] Tuberculosis (TB) is one of the oldest infectious diseases of human beings, and it is still the disease with the largest number of deaths caused by a single infection factor, which seriously threatens human health. In recent years, with the spread of AIDS and the rapid increase in the speed and quantity of the global population flow, the incidence of tuberculosis is on the rise. Especially in developing countries, poverty, backwardness, hunger, overcrowded population, and poor medical and health conditions make tuberculosis more difficult. get under control. According to WHO statistics, there are currently 1.722 billion people infected with tuberculosis bacteria in the world, and there are 9 million new tuberc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/31C12N15/63C12N1/21C07K14/35G01N33/68G01N33/569C12R1/19
Inventor 董梅孙彬吴纯杨采娥雷红孟祥红王迪
Owner THE 309TH HOSPITAL OF CHINESE PEOPLES LIBERATION ARMY