Mycobacterium tuberculosis recombinant protein and preparation method thereof
A technology of mycobacterium tuberculosis and protein, which is applied in the fields of genetic engineering technology, diagnostic reagents and vaccine development, can solve the problems of unsatisfactory sensitivity and achieve high sensitivity and strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Example 1 Preparation of tuberculosis recombinant protein
[0051] 1.1 Tuberculosis protein epitope screening and target gene cloning
[0052] The complete genome sequence of TB H37RV was analyzed by computer, and the DNA sequences of its strong epitope ricR protein (GenBank: GU726749.1), rpoB (GenBank: GQ395623.1) and GyrB (GenBank: AJ564417.1) were selected as templates, and the amplification was designed. The primers are:
[0053] ricR amplification primers:
[0054] F1: ATCGCATATG ATGACAGCAGCACACGGCTACACGCAGCA
[0055] 53.85% Tm=66.34
[0056] R1: AATCGCGCGCCTGGTTCGTTCCGGTGGTGGTGGTTGTTCTCGA
[0057] 60.47% Tm=67.79
[0058] rpoB amplification primers:
[0059] F2: GGTGGTGGTGGTTGTTCTCGACCGCGCTT
[0060] 62.07% Tm=61.06
[0061] R2::AGTCACCACCACCACCTCGCGGTTGTTCTGGATCAAA
[0062] 54.05%, Tm=65.51
[0063] GyrB amplification primers:
[0064] F3: GGTGGTGGTGGTGACTCGGCCGGCGGTTCTGCAAAAA
[0065] 62.16% Tm=65.54
[0066] R3: ATCGCTCGAGGTTCTTTAGCACCCGGTCGAT
[...
Embodiment 2
[0092] Example 2 Establishment of enzyme-linked immunoassay (ELISA) detection of Mycobacterium tuberculosis antibody IgG
[0093] The detection of Mycobacterium tuberculosis antibody IgG by indirect ELISA method can be used for identification of TB antigen activity and auxiliary diagnosis of TB infection. In this example, the Mycobacterium tuberculosis recombinant fusion protein prepared in Example 1 was used as the antigen; in order to determine the antigen coating amount and the working concentration of the enzyme-labeled secondary antibody, positive and negative reference materials were used as test samples, and the matrix titration method was used to select The optimal antigen coating amount and the corresponding enzyme-labeled secondary antibody working concentration are shown in Table 3 below.
[0094] Table 3 Selection of optimal antigen coating amount and corresponding enzyme-labeled secondary antibody working concentration
[0095]
[0096] According to the test res...
Embodiment 3
[0097] Example 3 Performance Verification of Mycobacterium tuberculosis IgG Antibody Detection Kit (Enzyme-linked Immunoassay)
[0098] The recombinant TB protein prepared in Example 1 was coated on a microwell plate, and the TB IgG antibody was determined by ELISA.
[0099] 3.1 The principle and components of the kit are as follows:
[0100] 1) The principle of the kit: This strain uses a microwell plate coated with genetically engineered recombinant TB antigen, horseradish peroxidase (HRP) labeled anti-human IgG as a tracer, TMB chromogenic system, and the principle of indirect method for detection Anti-TB IgG antibodies in human serum or plasma.
[0101] 2) The main components of the kit:
[0102] Pre-coated plate, enzyme conjugate, negative control, positive control, concentrated washing solution (20×), substrate solution A, substrate solution B, stop solution.
[0103] 3.2 Kit performance test
[0104] Determination of specificity: According to the indirect ELISA assa...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 