Application of trkA genes in deinococcus radiodurans R1 to culture of drought-resistant plant
A plant and gene technology, which is applied in the application field of cultivating drought-resistant plants with the R1 trkA gene of Deinococcus radiodurans, can solve the problems that there are no research reports on the function of trkA drought resistance.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1D
[0037]Example 1D. Expression of radiodurans R1 trkA gene (DR1666) sequence in Escherichia coli
[0038] Design a pair of PCR-specific primers based on the published sequence of the trkA gene (DR1666) in the D. radiodurans R1 genome:
[0039] Up 5'ATTAACTAGT GTGTGCTTCTACACTCAGC3'
[0040] Down 5'ACGCCATATGTTATTCCCCCAGATACCG3'
[0041] The target gene sequence was amplified from D. radiodurans R1 genomic DNA by PCR method. Reaction conditions: 94°C for 10 min, 35 cycles of [94°C for 30 sec, 58°C for 30 sec, 72°C for 1 min], 72°C for 10 min. After gel recovery, the PCR product was cloned on the vector pGEMT-easy, named pGEMT-trkA, and verified by sequencing; then the trkA gene (DR1666) with cohesive ends and pRADZ3 with promoter groEL were obtained by SpeI / NdeI double digestion Vector, the trkA gene (DR1666) was connected to the pRAD Z3 vector to construct the E. coli expression vector pRADZ3-trkA G, and the expression vector was transformed into E. coli JM109, and the inserte...
Embodiment 2
[0043] Example 2 Drought Resistance Experiment of Recombinant Strain Containing D.radiodurans R1 trkA Gene (DR1666)
[0044] 1. Experimental method
[0045] 1. Inoculate the 2 recombinant Escherichia coli obtained in Example 1 into 20mL LB liquid medium (containing Amp antibiotics) respectively, culture the shake flask overnight (37°C), and then transfer to 100mL LB liquid medium In the medium, try to keep the inoculum volume consistent, culture to OD 600 About 0.5 (try to keep OD 600 value is the same).
[0046] 2. After centrifuging 10mL of the bacterial solution, shock it in an equal volume of 3M sorbitol solution for 2 hours, and immediately dilute each sample to 10 times with sterile deionized water. -4 , Take 10 μL and spot on the surface of LB solid medium, culture at 37°C for 16 hours, observe the colony formation and take pictures.
[0047] 2. Experimental results
[0048] image 3 It shows that before the impact of 3M sorbitol solution, the growth state of the ...
Embodiment 3
[0051] Example 3 Expression of trkA gene (DR1666) in rapeseed and identification of drought resistance of transgenic plants
[0052] (1) Agrobacterium-mediated transformation of rapeseed experiment
[0053] 1. Preparation of competent Agrobacterium tumefaciens EHA105
[0054] 1) Pick a single colony, inoculate in 5mL YEB liquid medium (containing rifampicin Rif50mg / L), culture overnight at 28°C, 250rpm shaking;
[0055] 2) Take 2mL of bacterial liquid, add it to 50mL YEB liquid medium (containing Rif50mg / L), shake and culture at 28℃, 250rpm until OD 600 About 0.6 or so;
[0056] 3) Transfer the bacterial solution to a 50mL sterile centrifuge tube, bathe in ice for 30min, and centrifuge at 5000×g for 5min;
[0057] 4) Discard the supernatant and use 2mL 20mM CaCl for precipitation 2 Resuspended, 100 μL each was dispensed into 1.5 mL centrifuge tubes, and stored in liquid nitrogen for later use.
[0058] 2. Transformation of recombinant plasmid DNA into Agrobacterium
[00...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com