Supercharge Your Innovation With Domain-Expert AI Agents!

Application of trkA genes in deinococcus radiodurans R1 to culture of drought-resistant plant

A plant and gene technology, which is applied in the application field of cultivating drought-resistant plants with the R1 trkA gene of Deinococcus radiodurans, can solve the problems that there are no research reports on the function of trkA drought resistance.

Active Publication Date: 2012-12-05
LONGPING BIOTECHNOLOGY (HAINAN) CO LTD
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Although it is known that the protein encoded by trkA in D. radiodurans R1 radiation-resistant strain belongs to the HKT protein class and may have evolutionary synergy with plant Na+ transport, but there is no research report on the function of trkA in enhancing plant drought resistance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of trkA genes in deinococcus radiodurans R1 to culture of drought-resistant plant
  • Application of trkA genes in deinococcus radiodurans R1 to culture of drought-resistant plant
  • Application of trkA genes in deinococcus radiodurans R1 to culture of drought-resistant plant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1D

[0037]Example 1D. Expression of radiodurans R1 trkA gene (DR1666) sequence in Escherichia coli

[0038] Design a pair of PCR-specific primers based on the published sequence of the trkA gene (DR1666) in the D. radiodurans R1 genome:

[0039] Up 5'ATTAACTAGT GTGTGCTTCTACACTCAGC3'

[0040] Down 5'ACGCCATATGTTATTCCCCCAGATACCG3'

[0041] The target gene sequence was amplified from D. radiodurans R1 genomic DNA by PCR method. Reaction conditions: 94°C for 10 min, 35 cycles of [94°C for 30 sec, 58°C for 30 sec, 72°C for 1 min], 72°C for 10 min. After gel recovery, the PCR product was cloned on the vector pGEMT-easy, named pGEMT-trkA, and verified by sequencing; then the trkA gene (DR1666) with cohesive ends and pRADZ3 with promoter groEL were obtained by SpeI / NdeI double digestion Vector, the trkA gene (DR1666) was connected to the pRAD Z3 vector to construct the E. coli expression vector pRADZ3-trkA G, and the expression vector was transformed into E. coli JM109, and the inserte...

Embodiment 2

[0043] Example 2 Drought Resistance Experiment of Recombinant Strain Containing D.radiodurans R1 trkA Gene (DR1666)

[0044] 1. Experimental method

[0045] 1. Inoculate the 2 recombinant Escherichia coli obtained in Example 1 into 20mL LB liquid medium (containing Amp antibiotics) respectively, culture the shake flask overnight (37°C), and then transfer to 100mL LB liquid medium In the medium, try to keep the inoculum volume consistent, culture to OD 600 About 0.5 (try to keep OD 600 value is the same).

[0046] 2. After centrifuging 10mL of the bacterial solution, shock it in an equal volume of 3M sorbitol solution for 2 hours, and immediately dilute each sample to 10 times with sterile deionized water. -4 , Take 10 μL and spot on the surface of LB solid medium, culture at 37°C for 16 hours, observe the colony formation and take pictures.

[0047] 2. Experimental results

[0048] image 3 It shows that before the impact of 3M sorbitol solution, the growth state of the ...

Embodiment 3

[0051] Example 3 Expression of trkA gene (DR1666) in rapeseed and identification of drought resistance of transgenic plants

[0052] (1) Agrobacterium-mediated transformation of rapeseed experiment

[0053] 1. Preparation of competent Agrobacterium tumefaciens EHA105

[0054] 1) Pick a single colony, inoculate in 5mL YEB liquid medium (containing rifampicin Rif50mg / L), culture overnight at 28°C, 250rpm shaking;

[0055] 2) Take 2mL of bacterial liquid, add it to 50mL YEB liquid medium (containing Rif50mg / L), shake and culture at 28℃, 250rpm until OD 600 About 0.6 or so;

[0056] 3) Transfer the bacterial solution to a 50mL sterile centrifuge tube, bathe in ice for 30min, and centrifuge at 5000×g for 5min;

[0057] 4) Discard the supernatant and use 2mL 20mM CaCl for precipitation 2 Resuspended, 100 μL each was dispensed into 1.5 mL centrifuge tubes, and stored in liquid nitrogen for later use.

[0058] 2. Transformation of recombinant plasmid DNA into Agrobacterium

[00...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discovers that trkA genes (DR1666) in deinococcus radiodurans R1 have the function of enhancing stress tolerance of prokaryotes and plants. Recombinant vectors with such genes are built and respectively led into prokaryotic and eukaryotic host cells. The test proves that the trkA genes (DR1666) can enhance drought resistance after being expressed in the prokaryotic host cells and rapes.

Description

technical field [0001] The present invention relates to the new function of the trkA gene (DR1666, GeneID: 1798231) of Deinococcus radiodurans R1, and specifically relates to the application of the gene in enhancing the drought resistance of plants. Background technique [0002] Potassium is one of the three major mineral elements (N, P, K) necessary for plants, and has important physiological effects on plants. When plants are under salt stress, a large amount of Na + Enter the plant body from the root, making K + The absorption is inhibited, forming a low K + / Na + ratio, causing damage to plants. In this case, if it is possible to regulate K in plants + / Na + Balance, can resist excess Na + damage to plants. [0003] HKT (high-affinity K+transporter) gene family transporter can regulate K in plants + / Na + The ability to balance is widely found in plants, fungi, eubacteria and archaea. Deinococcus radiodurans R1 (D.radiodurans R1) contains two HKT-like proteins...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/84A01H5/00C12N15/70C12N1/21C12R1/01C12R1/19
Inventor 林敏王劲左开井陈明张维平淑珍陆伟燕永亮
Owner LONGPING BIOTECHNOLOGY (HAINAN) CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More