Application of HIN protein gene of deinococcus radiodurans R1 in salt-tolerant plant cultivation

A gene and protein technology, applied in the field of new functions of R1HIN protein gene of Deinococcus radiodurans, can solve unseen problems

Active Publication Date: 2013-01-02
LONGPING BIOTECHNOLOGY (HAINAN) CO LTD
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, there is no research report on the function of the R1 HIN protein gene (DR1372, GeneID: 1798946) of Deinococcus radiodurans in improving plant salt tolerance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of HIN protein gene of deinococcus radiodurans R1 in salt-tolerant plant cultivation
  • Application of HIN protein gene of deinococcus radiodurans R1 in salt-tolerant plant cultivation
  • Application of HIN protein gene of deinococcus radiodurans R1 in salt-tolerant plant cultivation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Expression of D.radiodurans R1 HIN protein gene (DR1372) sequence in Escherichia coli

[0035] According to the published sequence of the HIN protein gene (DR1372) in the D.radiodurans R1 genome, design a pair of PCR-specific primers to amplify the complete nucleotide sequence from D.radiodurans R1 genomic DNA:

[0036] Up 5′ATTA GAGCTATGAAGAAGATGGCTTTTG3';

[0037] Down 5′ACGC TCCTCAAAACACCGATAAAG3'.

[0038] The parts in black italics above are enzyme cleavage sites.

[0039] The target gene sequence was amplified from the genome of D.radiodurans R1 by PCR method, reaction conditions: 94°C 10min, [94°C 60sec, 55°C 30sec, 72°C 60sec] 30 cycles, 72°C 10min, the PCR product was gelatinized After recovery, it was cloned on the vector pGEMT-easy, named pGEMT-hin, and verified by sequencing; then the pRADZ3 vector containing cohesive ends and the promoter groEL was obtained by SpeI / NdeI double digestion, and the HIN protein gene (DR1372) Connected to the pR...

Embodiment 2

[0041] Example 2 Salt Tolerance Experiment of Recombinant Strain Containing D.radiodurans R1 HIN Protein Gene (DR1372)

[0042] 1. Experimental method

[0043] 1. The 2 recombinant Escherichia coli obtained in Example 1 were respectively inoculated in 20 mL of LB liquid medium (containing Amp antibiotics), and after the shake flask was cultured overnight (37° C.), they were then respectively transferred to 100 mL of LB liquid medium In the medium, try to keep the inoculum volume consistent, cultivate to OD 600 ≈0.5 is enough.

[0044] 2. After centrifuging 10 mL of the bacterial solution, shock it in an equal volume of 4M NaCl salt solution for 2 hours, and immediately dilute each sample to 10 times with sterile deionized water. -4 , Take 10 μL and spot on the surface of LB solid medium, culture at 37°C for 16 hours, observe the colony formation and take pictures.

[0045] 2. Experimental results

[0046] image 3 It shows that the growth state of the JM-hin strain containi...

Embodiment 3

[0049] Example 3 Expression of HIN protein gene (DR1372) in rapeseed and salt tolerance experiment of transgenic plants

[0050] (1) Agrobacterium-mediated transformation of rapeseed experiment

[0051] 1. Preparation of competent Agrobacterium tumefaciens EHA105

[0052] 1) Pick a single colony and inoculate it in 5mL YEB liquid medium (containing rifampicin Rif 50mg / L), and culture overnight at 28°C with shaking at 250rpm;

[0053] 2) Take 2mL of bacterial liquid, add it to 50mL YEB liquid medium (containing Rif 50mg / L), and culture at 28°C and 250rpm until OD 600 ≈0.6;

[0054] 3) Transfer the bacterial solution to a 50mL sterile centrifuge tube, bathe in ice for 30min, and centrifuge at 5000×g for 5min;

[0055] 4) Discard the supernatant, use 2mL 20mM CaCl for precipitation 2 Resuspended, 100 μL each was dispensed into 1.5mL centrifuge tubes, and stored in liquid nitrogen for later use.

[0056] 2. Transformation of recombinant plasmid DNA into Agrobacterium

[0057...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention finds that an HIN protein gene (DR1372) in deinococcus radiodurans R1 can improve anti-adversity ability of prokaryotic organisms and plants. The invention constructs a recombinant vector containing the gene, and respectively introduces the vector into prokaryotic and eukaryotic host cells. Experiment proves that after the HIN protein gene (DR1372) is expressed in prokaryotic host cells and plants, the salt tolerance of both the prokaryotic host cells and plants is improved.

Description

technical field [0001] The present invention relates to the new function of the HIN protein gene (DR1372, GeneID: 1798946) of Deinococcus radiodurans R1 (Deinococcus radiodurans R1), and specifically relates to the application of the gene in enhancing the resistance of plants to salt stress. Background technique [0002] Salt-alkali, drought and freezing damage are important stress factors that limit plant growth and development. During the stress process, plants induce the synthesis of a series of functional proteins to protect plant cells from damage under stress conditions (Shinozaki, 2007). A large number of studies have shown that HIN proteins play an important role in the process of plants resisting abiotic stresses such as high salinity. The protein encoded by the HIN protein gene DR1372 contained in D. radiodurans R1 belongs to the LEA2 family member and has protective effects on endosperm development and osmotic stress in plant growth organs (Campbell et al., 1997; ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12N15/70C12N15/82C12N15/84C12N1/21C12N5/10A01H5/00C12R1/19C12R1/01
Inventor王劲江世杰张维陈明陈震林敏
OwnerLONGPING BIOTECHNOLOGY (HAINAN) CO LTD