TRPCR (Template-Ready Polymerase Chain Reaction) detection kit for hTERTmRNA (human Telomerase Reverse Transcriptase messenger Ribonucleic Acid) and detection method thereof
A technology for detection kits and kits, which is applied in the direction of fluorescence/phosphorescence, material excitation analysis, etc., can solve the problems of system optimization limitations, high operation requirements, and complicated processes, and achieve enhanced specific amplification efficiency, high standardization, and utilization high rate effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1: Washing to remove non-immobilized probe B
[0032] Probe B for detecting hTERT mRNA: 5'-CAGGAGCAGCATTCCATCACGCTCCTTCAGGCAGGACACCTGGCGGAAGGAGGGGGCCGTCGCAGGTCCAGAGAAGG-3', the shaded part is the complementary sequence that binds to mRNA, and the PCR primer sequences at both ends. PCR primers: TAB1: CAGGAGCAGCATTCCATCACG, TAB2: CCTTCTCTGGACCTGCGACG.
[0033] Lung cancer cell line A549 cells were cultured in a 24-well plate, 1000 cells / well, after overnight culture, the culture medium was aspirated, + 200ul lysate B (the concentration of probe B added to the lysate was 1nmol / L), and repeatedly aspirated Beat, transfer to a 1.5 ml centrifuge tube, place on ice for 20 minutes, centrifuge at 15,000 rpm at 4°C for 20 minutes, take the supernatant to obtain the cell lysate supernatant;
[0034] The composition of lysate B is as follows: 1% SDS, 500mmol / L NaCl, 2mmol / L MgCl 2 , 10mmol / L 2-mercaptoethanol, 0.1mg / ml protamine DNA (Sigma company), 0.1% Tween20, 1% skimm...
Embodiment 2
[0040] Example 2: Fabrication of anchor tubes by magnetic bead method
[0041] Probe A for anchoring hTERT mRNA: 5'-GACTCAGCTGCGTCTGGGCTGTCCTGAGTGACCCCA. TBST buffer 20ul, containing 10ug Dynabeads? M-280 streptavidin magnetic beads and 2pmol biotinylated probe A (biotinylated probe A is directly modified and added to the 5' end during synthesis), loaded In a 0.2ml PCR thin-walled tube, at room temperature for 1hr, use a magnet to absorb the magnetic beads in the tube wall, blot the liquid in the tube, add 50ul TBST buffer, mix well, blot dry, repeat this way for a total of 6 times, and finally blot dry ; Add 50ul TE buffer, set aside.
[0042] Cell lysis: 24-well plate cell culture, absorb the culture medium, + 200ul lysate B (same as Example 1), pipette repeatedly, transfer to a 1.5 ml centrifuge tube, place on ice for 20min, centrifuge at 4°C, 15000 rpm for 20min, Take the supernatant to obtain the cell lysate supernatant. Then use a magnet to adsorb the magnetic beads o...
Embodiment 3
[0045] Example 3: direct PCR in-tube coupling to make anchor tubes
[0046] 50ul of TBST buffer, containing 5pmol biotinylated hTERT probe A (see Example 2), put into a streptavidin-coated 0.2ml PCR thin-walled tube, room temperature for 1hr, blot the liquid in the tube, and add 100ul TBST buffer, beat well, blot dry, wash repeatedly in this way for a total of 3 times, and finally blot dry; add 100ul TE buffer, then blot the liquid in the tube, add 50ul cell lysate supernatant (same as Example 1), 64°C Incubate for 10 minutes, then dry the liquid in the tube, wash 7 times with TBST buffer, add 50ul PCR reaction solution (SYBR fluorescence quantification), and perform PCR program (pre-denaturation at 93°C for 3min, then 40 cycles of 93°C for 3s, 62°C for 30s , two-step method), SYBR fluorescence quantitative analysis. With this method, 10-10000 A549 cells can be tested and positive results can be obtained (the Ct value of the supernatant of the cell lysate is less than the Ct v...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More