Unlock instant, AI-driven research and patent intelligence for your innovation.

Feedback inhibition weakening method for producing glutathione by bacterial strains

A technology of glutathione and bacterial strains, applied in the field of bioengineering, can solve problems such as cytotoxicity, achieve the effects of increasing production, weakening feedback inhibition, and reducing costs and energy consumption

Inactive Publication Date: 2013-02-06
CHINA PHARM UNIV
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Moreover, the addition of some surfactants can cause certain toxicity to the cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Feedback inhibition weakening method for producing glutathione by bacterial strains
  • Feedback inhibition weakening method for producing glutathione by bacterial strains
  • Feedback inhibition weakening method for producing glutathione by bacterial strains

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Construction of two expression plasmids

[0031] 1.1 Primer design

[0032] According to the GSH1 and GSH2 sequences reported by NCBI, the following 4 primers were designed:

[0033] GSH1UP: CGC GGATCC ATGATCCCGGACGTATCACAGGC;

[0034] GSH1DOWN: CCC AAGCTTT CAGGCGTGTTTTTCCAGCCACACC;

[0035] GSH2UP:GC TCTAGA GATGATCAAGCTCGGCATCGT;

[0036] GSH2DOWN: ATGAAGCTTTTACTGCTGCTGTAAACGTGC.

[0037] Among them, GSH1UP and GSH1DOWN are used to amplify the GSH1 coding region; GSH2UP and GSH2DOWN are used to amplify the GSH coding region; the underlines on GSH1UP, GSH1DOWN, GSH2UP, and GSH2DOWN represent the BamH I and Hind introduced on GSH1UP, GSH1DOWN, GSH2UP, and GSH2DOWN respectively. III, XbaI and Hind III restriction sites.

[0038] 1.2 PCR amplification of GSH1 and GSH2 sequences

[0039] The genome of Escherichia coli E.coli BL21(DE3) was extracted.

[0040] Using the Escherichia coli E.coli BL21 (DE3) genome as a template, and using GSH1UP and GSH1...

Embodiment 2

[0054] Example 2 Two-plasmid construction

[0055] Extract the two plasmids from the Escherichia coli carrying the plasmids pET28a-GSH1 and pBAD24-GSH2 obtained in 1.3.1 and transform them together into the host strain E.coli BL21(DE3), and smear and contain 60μg / mL card The solid LB plates of Namycin and Ampicillin were cultured at 37°C until the transformants grew out. Among them, E.coli BL21 (DE3) is a strain without kanamycin and ampicillin resistance, and cannot grow on a solid LB plate containing kanamycin and ampicillin. Therefore, the transformants grown on the plate are transformed coli with pET28a-GSH1 and pBAD24-GSH2 plasmids.

[0056] A number of transformants containing pET28a-GSH1 and pBAD24-GSH2 plasmids were randomly selected, shake flask fermentation culture, and two Escherichia coli strains with higher glutathione accumulation were selected respectively, and one strain was named BL21-GSH12.

[0057] At the same time, the extracted pET28a-GSH1 and pBAD24-G...

Embodiment 3

[0061] Example 3 BL21-GSH1, BL21-GSH2, BL21-GSH12 and E.coli BL21(DE3) Shake Flask Fermented Glutathione

[0062] A single colony of BL21-GSH1, BL21-GSH2, BL21-GSH12 and E.coliBL21(DE3) (original bacteria, named BL21) grown overnight on a solid LB plate at 37°C was inserted into the liquid LB medium respectively, Shake flasks were incubated overnight.

[0063] Take an appropriate amount of bacterial liquid and transfer it into the shake flask fermentation medium, and cultivate for 10 h. Among them, the inducer was added at an appropriate time; the precursor amino acid was added at an appropriate time and samples were taken at 3, 5, 7, 9, and 11 hours of fermentation to detect the accumulation of glutathione in the fermentation product. The test results are shown in Table 1.

[0064] According to the results in Table 1, the cumulative amount of L-5-methyltetrahydrofolate in BL21-GSH1, BL21-GSH2, BL21-GSH12 and E.coli BL21(DE3) reached the highest at 11 hours of fermentat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a glutathione synthetase-based recombinant plasmid, a construction method and application thereof, and a method for accumulating glutathione. The glutathione synthetase-based recombinant plasmid provided by the invention includes sequences GSH1 and GSH2 as well as two appropriate vector segments; the principle of the method lies in that as GSH1 and GSH2 are connected onto vectors with different promoters, step-by-step expression of GSH1 and GSH2 can be realized through adding inducers at different time to reduce feedback inhibition; with the adoption of the method provided by the invention, the feedback inhibition can be weakened remarkably, the yield of glutathione is improved, the utilization ratio of raw materials is improved, and a base model is established for further studying synthesis of glutathione by a biological method. In addition, the method and the idea can be applied to target products of which the yield improvement is restricted due to the feedback inhibition, and provide a new idea for producing valuable products.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a method for increasing glutathione accumulation by using a bacterial strain with weakened feedback inhibition. Background technique [0002] Glutathione (γ-L-glutamyl-cysteinyl-glycine, GSH), a biologically active tripeptide compound composed of L-glutamic acid, L-cysteine ​​and glycine, is an important antioxidant and Major non-protein thiols (>90%). In biological tissues, glutathione maintains the dynamic balance between oxidized and reduced forms through glutathione reductase, and plays a role in cell protection, substance metabolism, information regulation, regulation of cell and tissue development, and resistance to or induction of diseases. Therefore, it is widely used in medicine and health care, skin care and beauty, food additives and other industries. For the production of glutathione, it has experienced extraction method, chemical synthesis met...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12N15/66C12N15/70C12P21/02
Inventor 许激扬卞筱泓赵玉成邵飞
Owner CHINA PHARM UNIV