Method for detecting egg laying amount of insects by heat shock protein 90 gene

A technology of insect egg production and heat shock protein, applied in the field of detection of insect egg production with heat shock protein 90 gene, can solve the problems of time-consuming, labor-intensive and expensive, and achieve the effect of easy purchase, simple operation and wide source of materials

Inactive Publication Date: 2013-05-08
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the detection method for the egg production of commercial stinkbugs from different food sources or different merchants is still to test the egg production during the entire adult stage or within an artificially specified time, which is time-consuming, laborious and expensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting egg laying amount of insects by heat shock protein 90 gene
  • Method for detecting egg laying amount of insects by heat shock protein 90 gene
  • Method for detecting egg laying amount of insects by heat shock protein 90 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1. Discovery of Heat Shock Protein 90 and its Encoding Gene for Detecting Insect Oviposition and Design of Special Primers

[0044] Studies have found that the heat shock protein 90 gene is a good molecular marker for detecting the amount of eggs laid by insects. Therefore, the present invention uses the expression of the heat shock protein 90 (heat shock protein 90) coding gene of the stinkbug to detect the production of the stinkbug. Egg volume.

[0045] The nucleotide sequence of the heat shock protein 90 coding gene of the stinkbug is sequence 1 in the sequence listing or sequence 1 in the sequence listing from the 2nd to 331st nucleotides at the 5' end, and the amino acid sequence of the protein is in the sequence listing Sequence 2 of .

[0046] The primers designed to amplify the coding gene according to the heat shock protein 90 coding gene of the stinkbug are as follows:

[0047] Upstream primer: GAAGGTGAGGATGATAAGCCCAA (SEQ ID NO: 3);

[0048] Downs...

Embodiment 2

[0049] Example 2, the application of heat shock protein 90 or coding gene or special primers in detecting the amount of eggs laid by stinkbugs

[0050] The stink bug (Arma chinensis) adopted in the following experiments is recorded in Taxonomic and bionomic notes on Arma chinensis (Fallou) (Hemiptera: Pentatomidae: Asopinae, Zootaxa, 3382: 41-52, 2012, the public can obtain from Institute of Plant Protection, Chinese Academy of Agricultural Sciences Obtained) were divided into two groups according to the quality of food taken, 50 in each group:

[0051] Bacteria gnats eating artificial diet: stinkbugs fed artificial diet (27±1°C, 16:8(L:D), 75±5%RH) were fed with 160 μl of artificial diet per adult per day until the gnats fed artificial diet Stinkbugs die naturally;

[0052] The prey-feeding group of gnats: the gnats that feed on prey (27±1°C, 16:8(L:D), 75±5%RH) each pair of adults feeds one prey, every 7-15 days according to When the prey is eaten, the prey is replaced onc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting the egg laying amount of insects by a heat shock protein 90 gene, which provides application of a substance which is used for detecting the expression quantity of heat shock protein 90 encoding genes of insect populations eating different substances to detection of the egg laying amount of insect populations eating different substances, wherein the amino acid sequence of heat shock protein 90 is a sequence 2 in the sequence table. Experiments prove that the detection method provided by the invention can be used for detecting the egg laying amount of the insects and particularly the egg laying amount of arma chinensis with different nutrition sources, and the egg laying amount of the insects can be detected within only 2 to 3 days by the detection method while the detection requires 30 to 60 days by a traditional biological method. The detection method provided by the invention has the advantages that materials have wide sources and are easily available, and the operation is simple as well as time-saving and labor-saving, thus being suitable for popularization and application in insect commodity inspection and detection.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for detecting insect egg production by using heat shock protein 90 gene. Background technique [0002] Biological pest control plays an irreplaceable and important role in the sustainable development of agriculture and forestry. The mass production of natural enemy insects is the most basic and important link in biological control. The predatory natural enemy insect, Armachinensis, can control a variety of agricultural and forestry pests from Lepidoptera, Coleoptera, Hemiptera, Homoptera, Hymenoptera, etc., especially it can also control the major invasive pests potato beetle and American The white moth, so the stinkbug is a kind of natural enemy insect commodity with good application prospect. [0003] As a commodity, reducing the cost of production is a way for people to pursue profit maximization. In the production of the natural enemy insect, the stink bug, different ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11C12N15/12C07K14/435
Inventor邹德玉陈红印张礼生王树英陈长风王孟卿刘晨曦
OwnerINST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI