Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Sickle-alfalfa chloroplast cold-response protein (MfcpCOR14) and coding gene and application thereof

A technology of alfalfa and chloroplasts, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problem of few studies on isolating cold-resistant genes, and achieve the effect of improving cold resistance and strong light resistance

Inactive Publication Date: 2014-03-12
SOUTH CHINA AGRI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The changes in mRNA and protein of Medicago sativa during cold acclimatization (Chinnusamy et al. Few studies have been conducted on isolating cold resistance genes from alfalfa

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sickle-alfalfa chloroplast cold-response protein (MfcpCOR14) and coding gene and application thereof
  • Sickle-alfalfa chloroplast cold-response protein (MfcpCOR14) and coding gene and application thereof
  • Sickle-alfalfa chloroplast cold-response protein (MfcpCOR14) and coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Cloning of embodiment 1MfcpCOR14

[0051] 1. Preparation of Medicago cDNA template

[0052] Seeds of Medicago falcata were soaked in hot water at 60°C for 5 minutes, and germinated in the dark at 28°C. When the seeds were white, they were sown in plastic pots (15 cm in diameter) filled with soil and cultivated in the greenhouse. Light, temperature 25-28 ℃. Put the 8-10-week-old Medicago sativa plants into an artificial climate box at a temperature of 5°C (light intensity of 200 μmol·m -2 the s -1 ), the light / dark cycle was 12 hours of light, and the low temperature treatment was carried out at 5°C for 2 consecutive days. Mature leaves of Medicago sativa were taken, and total RNA was extracted by TRE-Trizol method, reverse-transcribed with M-MLV reverse transcriptase kit (Promega Company) to obtain reverse-transcribed first-strand cDNA as a template, and stored at -20°C for future use.

[0053] 2. Design and amplify the primers of MfcpCOR14 gene

[0054] According ...

Embodiment 2

[0067] Example 2 Construction of the plant expression vector (pBI-MfcpCOR14) of the MfcpCOR14 gene

[0068] Since the MfcpCOR14 gene is reversely connected to the pMD20-T vector, design amplification primers with BamHI and XbaI restriction sites according to the flanking sequences of the insertion site of the pMD20-T vector:

[0069] The upstream primer pMD1 introducing the BamHI restriction site: GATC GGATCC GAGGATCTACTAGTCATATGG;

[0070] Mutate the original BamHI restriction site and introduce the downstream primer pMD2 of the XbaⅠ restriction site: GTGA TCTAGA GCTCGGTACCCGG AAA ATCCGA;

[0071] The cloning vector pMD-MfcpCOR14 constructed in Example 1 was used as a template, and pMD1 and pMD2 were used as upstream and downstream primers to perform PCR amplification of the MfcpCOR14 gene, and the amplified MfcpCOR14 gene fragment was purified and recovered.

[0072] The MfcpCOR14 gene fragment and the pBI121 expression vector recovered above were double-digested with ...

Embodiment 3

[0073] Example 3 MfcpCOR14 expression induced by low temperature

[0074] 1. Obtaining the Medicago sativa template under low temperature conditions

[0075] Put the 8-10-week-old Medicago sativa plants into an artificial climate chamber at a temperature of 5°C (200 μmol·m -2 the s -1 ), the light and dark time were both set to 12 hours of light. Continuous treatment for 4 days, low temperature treatment at 5°C. Take the mature leaves of low temperature treatment for 0h, 12h, 24h, 48h, and 96h respectively, add liquid nitrogen to grind the samples, extract the total RNA of the leaves with TRE-Trizol reagent, and use PrimeScript TM RT reagent Kit (TaKaRa Company) was reverse-transcribed to obtain reverse-transcribed first-strand cDNA as a cDNA template, which was stored at -20°C for future use.

[0076] 2. Design specific detection primers

[0077] According to the cDNA sequence of MfcpCOR14 gene and the sequence of truncated alfalfa Actin (MTR3g095530), quantitative prime...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a sickle-alfalfa chloroplast cold-response protein (MfcpCOR14) and a coding gene and an application thereof and belongs to the field of plant genetic engineering. An MfcpCOR14 gene is obtained, the obtained MfcpCOR14 gene is used for constructing a plant expression vector, the constructed plant expression vector is used for converting a plant tissue, and the plant tissue is cultured into a transgenic plant. The expression of the MfcpCOR14 gene can be induced at low temperature. The invention provides a method for culturing a cold and strong light resisting plant by using the MfcpCOR14 gene. After the MfcpCOR14 gene is used for over-expressing the protein of a plant, the growth of the transgenic plant can be superior to that of a wild plant, and the cold and strong light resisting capacity of the transgenic plant can be improved significantly.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and relates to a chloroplast cold response protein MfcpCOR14 of Medicago clover and its encoding gene and application. Background technique [0002] Plant growth and crop yield can be severely affected by a variety of adverse environmental conditions, and tropical plants are particularly vulnerable to damage from low temperatures. Breeding stress-tolerant plant varieties is one of the main goals of the crop industry. However, plant stress tolerance is a quantitative trait involving at least hundreds of genes, so it is necessary to isolate tolerance genes from plants with strong stress tolerance. [0003] Yellow clover (Medicago sativa subsp. falcata) is a very cold-resistant leguminous forage germplasm, which is also distributed in cold Siberia, from which cold-resistant genes can be cloned, which can provide better target genes for transgenic breeding, and for agricultural and forestry ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H4/00A01H5/00
Inventor 郭振飞卓春柳
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com