Method for improving plant heavy metal tolerance and regulating heavy metal oriented distribution

A heavy metal, tolerance technology, applied in the fields of botanical equipment and methods, biochemical equipment and methods, plant products, etc., can solve the problem of unclear molecular mechanism of reduction and migration, etc.

Inactive Publication Date: 2013-07-03
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The method of using molecular breeding to reduce the content of cadmium in edible parts such as crop grains has good and broad development prospects, but there are still many problems in the research on the absorption, transport and resistance mechanism of heavy metal cadmium in plants, especially in the edible parts such as grains. The molecular mechanism of site migration is still poorly understood

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving plant heavy metal tolerance and regulating heavy metal oriented distribution
  • Method for improving plant heavy metal tolerance and regulating heavy metal oriented distribution
  • Method for improving plant heavy metal tolerance and regulating heavy metal oriented distribution

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0137] Example 1. Cloning and Transformation of Tonoplast Membrane Transporter Gene SpHMT1

[0138] The present inventors used fission yeast (S. pombe) cDNA as a template, through SpHMT1 cloning primers (SpHMT1(+)-PCR and SpHMT1(-)-PCR), and KOD-plus reaction system to amplify the 5'-UTR in SpHMT1 full-length cDNA within. At the same time, primers (K-SpHMT1(+)-PCR and K-SpHMT1(-)-PCR) were designed to clone the cDNA that replaced the 5'-UTR of yeast itself with the Kozak sequence conserved in higher plants. Primers were designed to mutate the stop codon of cDNA (from sequence TAA to TCA) and introduce SpeI restriction site. The cDNA was constructed into the 35S / TaPCS1:cmyc-pBI121 expression vector using the SpeI restriction site (references Jiming GONG et al., Long-distance root-to-shoot transport of phytochelatins and cadmium in Arabidopsis. (2003); PNAS, vol. 100, no.17, 10118-10123; constructed as follows: introduce wheat TaPCS1 containing BamHI / SpeI sites at both ends in...

Embodiment 2

[0165] Example 2, the successful overexpression of yeast gene SpHMT1 in Arabidopsis

[0166] The preparation method of transgenic plants (35S:SpHMT1 / Col-0; 35S:SpHMT1 / cad1-3; Adh:SpHMT1 / Col-0) is as follows:

[0167] The plasmid 35S / SpHMT1:cmyc-pBI121 constructed above was used to transform wild-type C01-0 and AtPCS1 deletion mutant cad1-3, respectively. The previously constructed plasmid Adh / SpHMT1:cmyc-pBI121 was transformed into wild-type Col-0. Arabidopsis transformation method refers to the literature Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. (1998)

[0168] In the shoots, leaves and roots of transgenic Arabidopsis plants 35S:SpHMT1 / Col-0, Adh:SpHMT1 / Col-0 and 35S:SpHMT1 / cad1-3, the expression of SphMT1 was analyzed by RT-PCR.

[0169] RT-PCR primer sequences:

[0170] SpHMT1(+) RT-PCR: TATCTTAAGCAAGAGCGGAAGG (SEQ ID NO: 5);

[0171] SpHMT1(-) RT-PCR: CTTTAAGCCTCTTTCTCCGACA (SEQ ID NO: 6);

[0172] AtACT1 (+) R...

Embodiment 3

[0184] Example 3, SpHMT1 gene can enhance the resistance and accumulation of wild-type Arabidopsis to heavy metals, and its function depends on phytochelatin PCs

[0185] Heavy metal resistance plate test:

[0186] The T3 generation of transgenic plants and the corresponding control were vertically cultured on the 1 / 4×MS plate with different concentrations of heavy metals after the seed surface was sterilized. After about 4 weeks of growth, they were photographed and observed, and the fresh weight was counted.

[0187] Determination of heavy metal content:

[0188] After the heavy metal treatment, the plant material was washed twice with deionized water for 4 min each time, and then washed with 25 mM CaCl 2 (PH4-5) wash twice, 4min each time, and finally rinse in Milli-Q water. 80°C, 48 hours. Weigh the dry weight, add 1 mL of 70% nitric acid (MOS grade), and let stand for 12 hours. Nitrolysis at 99°C for 2 hours, cooled to room temperature, diluted to 14 mL with Milli-Q w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for improving plant heavy metal tolerance and regulating heavy metal oriented distribution. According to the invention, for a first time, vacuolar membrane transporter protein HMT1 gene is expressed in plant, such that plant heavy metal tolerance is improved. Through tissue-specific expression of the gene, heavy metal oriented distribution in plant is realized. The gene provided by the invention can be used in plant variety improvement. With the gene, plant heavy metal resistance can be improved, heavy metal contents in different tissues and organs of plant can be regulated, heavy metal content in plant edible part can be reduced, plant reparation can be promoted, plant chlorophyll content under stresses of heavy metals such as cadmium can be increased, and the like. The invention provides a valuable gene oriented expression operation method for culturing plant novel varieties by using molecular breeding technologies such as genetic modification.

Description

technical field [0001] The invention belongs to the field of biotechnology; more specifically, the invention relates to the action mechanism of improving heavy metal tolerance and regulating heavy metal directional distribution by using tonoplast membrane transporter HMT1 and its application. Background technique [0002] In recent years, due to the development of modern industry, more and more heavy metals, such as cadmium, arsenic, lead, etc., have been discharged into the biosphere. The pollution of heavy metals such as cadmium not only leads to crop yield reduction, but also poses a threat to food safety. Cadmium is one of the most toxic heavy metals, and it is known as a class IA carcinogen that is most likely to accumulate in the body. Excessive cadmium in food and water accumulates in human tissues and organs through the food chain, causing various hazards, including damage to the kidneys, liver, and even cancer. [0003] Therefore, the remediation of soil contamina...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N15/84A01H5/00
Inventor龚继明黄婧
OwnerSHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI