Low molecular weight glutenin subunit gene of triticum turgidum ssp.dicoccum, and protein encoded by the same
A protein and DNA molecule technology, applied in genetic engineering, plant genetic improvement, dough processing, etc., can solve the problems of rare variation research, improve kneading quality, improve gluten strength and tensile properties, improve The effect of pasta processing quality
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1 Isolation and Sequence Analysis of Cultivated Emmer TdLMW-ml Gene
[0027] 1. Genomic DNA extraction
[0028] Genomic DNA was extracted from wheat leaves (100 mg of fresh leaf tissue) using a plant genomic DNA extraction kit based on the CTAB method (from Tiangen Biochemical Technology (Beijing) Co., Ltd.), and all operations were performed according to the instructions.
[0029] 2. PCR primer design and amplification:
[0030] According to the known low-molecular-weight glutenin subunit gene sequence from the NCBI database, the following primers were designed by analyzing the 5' and 3' conserved regions of the coding gene:
[0031] Upstream primer: ATGAAGACCTTCCTCGTCTTTGCCCT
[0032] Downstream primer: TCAGTAGACACCAACTCCGATG
[0033] The PCR reaction system for amplifying the low molecular weight glutenin subunit gene in cultivated emmer wheat using genomic DNA as a template is as follows:
[0034]
[0035] PCR reaction program: (1) 94°C for 5 minutes ...
Embodiment 2
[0059] Example 2 Construction of Prokaryotic Expression Vector of Cultivated Emmer Wheat Low Molecular Weight Glutenin Subunit Gene TdLMW-ml
[0060] The prokaryotic expression vector used in this example is pET-32a (from Novagen, a subsidiary brand of Merck, Germany). According to the sequence information of the TdLMW-ml gene (as shown in SEQ ID No.1), primers were designed respectively at the beginning of the gene sequence (excluding the nucleotide coding sequence corresponding to the signal peptide) and the end, and the BamH I and HindIII restriction sites were introduced before and after the gene sequence. Primers are as follows:
[0061] Upstream primers: GGATCC GATGGATACTAGCTGCATCCC
[0062] (The underline is the restriction site of BamH I)
[0063] Downstream primers: AAGCTT TCAGTAGACACCAACTCCGATG
[0064] (The underline is the restriction site of HindIII)
[0065] Adopt above-mentioned primers to carry out PCR reaction with the carrier (see embodiment 1) that ...
Embodiment 3
[0070] Expression and purification of the protein encoded by the TdLMW-ml gene in Escherichia coli
[0071] 1. Induced massive expression of TdLMW-ml gene in Escherichia coli
[0072] The pET32-tdLMW vector was transformed into E. coli BL21 strain (purchased from Beijing Tiangen Biochemical Technology Co., Ltd.), and the positive E. coli strain containing the pET32-tdLMW vector was identified by PCR (see Example 1 for details). When the BL21 strain transfected with pET32-tdLMW vector was shaken at 37°C until the OD value was 0.6, 0.5mM IPTG was added to induce the expression of the TdLMW-ml gene on the pET32-tdLMW vector. After shaking at 200rpm for 5 hours, the bacteria were collected by centrifugation at 8000rpm at 4°C. body. Take part of the bacteria resuspended in SDS-PAGE loading buffer, boil for 10min, and use for SDS-PAGE detection and analysis of the expression of TdLMW-ml recombinant protein in Escherichia coli (results are shown in the attached Figure 5 ).
[007...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com