Low molecular weight glutenin subunit gene of triticum turgidum ssp.dicoccum, and protein encoded by the same

A protein and DNA molecule technology, applied in genetic engineering, plant genetic improvement, dough processing, etc., can solve the problems of rare variation research, improve kneading quality, improve gluten strength and tensile properties, improve The effect of pasta processing quality

Inactive Publication Date: 2013-08-07
HUAZHONG UNIV OF SCI & TECH
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the cloning of LMW-GS is mainly concentrated in different varieties of common wheat. In recent years, some studies on LMW-GS gene cloning have been extended to a kind of close relative species of wheat, Goat grass. GS variation studies and new gene cloning are rare

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Low molecular weight glutenin subunit gene of triticum turgidum ssp.dicoccum, and protein encoded by the same
  • Low molecular weight glutenin subunit gene of triticum turgidum ssp.dicoccum, and protein encoded by the same
  • Low molecular weight glutenin subunit gene of triticum turgidum ssp.dicoccum, and protein encoded by the same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Isolation and Sequence Analysis of Cultivated Emmer TdLMW-ml Gene

[0027] 1. Genomic DNA extraction

[0028] Genomic DNA was extracted from wheat leaves (100 mg of fresh leaf tissue) using a plant genomic DNA extraction kit based on the CTAB method (from Tiangen Biochemical Technology (Beijing) Co., Ltd.), and all operations were performed according to the instructions.

[0029] 2. PCR primer design and amplification:

[0030] According to the known low-molecular-weight glutenin subunit gene sequence from the NCBI database, the following primers were designed by analyzing the 5' and 3' conserved regions of the coding gene:

[0031] Upstream primer: ATGAAGACCTTCCTCGTCTTTGCCCT

[0032] Downstream primer: TCAGTAGACACCAACTCCGATG

[0033] The PCR reaction system for amplifying the low molecular weight glutenin subunit gene in cultivated emmer wheat using genomic DNA as a template is as follows:

[0034]

[0035] PCR reaction program: (1) 94°C for 5 minutes ...

Embodiment 2

[0059] Example 2 Construction of Prokaryotic Expression Vector of Cultivated Emmer Wheat Low Molecular Weight Glutenin Subunit Gene TdLMW-ml

[0060] The prokaryotic expression vector used in this example is pET-32a (from Novagen, a subsidiary brand of Merck, Germany). According to the sequence information of the TdLMW-ml gene (as shown in SEQ ID No.1), primers were designed respectively at the beginning of the gene sequence (excluding the nucleotide coding sequence corresponding to the signal peptide) and the end, and the BamH I and HindIII restriction sites were introduced before and after the gene sequence. Primers are as follows:

[0061] Upstream primers: GGATCC GATGGATACTAGCTGCATCCC

[0062] (The underline is the restriction site of BamH I)

[0063] Downstream primers: AAGCTT TCAGTAGACACCAACTCCGATG

[0064] (The underline is the restriction site of HindIII)

[0065] Adopt above-mentioned primers to carry out PCR reaction with the carrier (see embodiment 1) that ...

Embodiment 3

[0070] Expression and purification of the protein encoded by the TdLMW-ml gene in Escherichia coli

[0071] 1. Induced massive expression of TdLMW-ml gene in Escherichia coli

[0072] The pET32-tdLMW vector was transformed into E. coli BL21 strain (purchased from Beijing Tiangen Biochemical Technology Co., Ltd.), and the positive E. coli strain containing the pET32-tdLMW vector was identified by PCR (see Example 1 for details). When the BL21 strain transfected with pET32-tdLMW vector was shaken at 37°C until the OD value was 0.6, 0.5mM IPTG was added to induce the expression of the TdLMW-ml gene on the pET32-tdLMW vector. After shaking at 200rpm for 5 hours, the bacteria were collected by centrifugation at 8000rpm at 4°C. body. Take part of the bacteria resuspended in SDS-PAGE loading buffer, boil for 10min, and use for SDS-PAGE detection and analysis of the expression of TdLMW-ml recombinant protein in Escherichia coli (results are shown in the attached Figure 5 ).

[007...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

According to the present invention, low molecular weight glutenin subunit gene (named TdLMW-m1) from triticum turgidum ssp.dicoccum and protein encoded by the low molecular weight glutenin subunit gene are provided, a TdLMW-m1 gene-containing escherichia coli expression vector is constructed, the recombinant vector is transformed into escherichia coli to carry out expression purification to obtain the protein encoded by the TdLMW-m1 gene, and the protein is added to flour so as to improve kneading property of flour and enhance gluten strength and tension resistance of dough.

Description

technical field [0001] The invention belongs to the technical field of biogenetic engineering, and relates to the nucleic acid sequence of the low-molecular-weight glutenin subunit gene of cultivated emmer wheat, the protein encoded by it, and the application of the protein in improving the performance of flour. Background technique [0002] Wheat is one of the three major food crops with the largest cultivated area and the most widely planted in the world. Due to its unique viscoelasticity and extensibility, the dough formed from wheat flour can be processed into various pasta, including bread, cakes, noodles and biscuits. The unique properties of wheat dough are due to the storage proteins in its seeds. The storage proteins in wheat are mainly divided into glutenin and gliadin, and glutenin can be further divided into two types according to the molecular weight: high-molecular-weight glutenin subunits (HMW-GS) and low-molecular-weight glutenin subunits (HMW-GS) and low-mo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/63C07K14/415C12N1/19C12N1/21A21D2/26C12N15/29
Inventor何光源杨广笑李引王琼李小燕肖欣孙福生
OwnerHUAZHONG UNIV OF SCI & TECH