Unlock instant, AI-driven research and patent intelligence for your innovation.

Oxygenase gene caceO as well as coded protein and application of oxygenase gene

A gene coding, oxygenase technology, applied in the field of applied environmental microorganisms and agriculture, can solve problems such as phytotoxicity, agricultural loss, crop phytotoxicity, etc.

Active Publication Date: 2014-07-02
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In addition, chloroacetamide herbicides such as acetochlor and butachlor have serious phytotoxicity to crops, especially in sandy soil with low organic matter content, or excessive dosage, or continuous low temperature after application In high humidity weather, it will seriously affect the growth of crops. In recent years, crop injury caused by improper use of acetochlor and butachlor in my country has occurred from time to time, causing serious losses to agriculture.
[0006] Therefore, the residual pollution of chlorinated acetamide herbicides in the soil and water environment seriously endangers human health, destroys the ecological environment and has serious phytotoxicity to crops.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oxygenase gene caceO as well as coded protein and application of oxygenase gene
  • Oxygenase gene caceO as well as coded protein and application of oxygenase gene
  • Oxygenase gene caceO as well as coded protein and application of oxygenase gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Embodiment 1. Cloning of acetochlor degradation gene (strategy diagram sees figure 1 )

[0040] 1.1 Obtaining of Mutant Strain DC-2MUT

[0041] At room temperature, the water solubility of acetochlor is 225mg / kg, so the LB plate containing 400mg / kg acetochlor is turbid. Acetochlor) will appear in a transparent circle when incubated at 30°C, and the degradation of acetochlor can be easily judged by naked eyes. However, after many passages, it was found that a colony did not produce a transparent circle around it. Select this colony and put it into 100ml LB liquid medium. After the strain is cultivated to the late logarithmic period, wash it twice with 6,000 centrifuged distilled water, and resuspend it to 20ml (containing 100mg / kg acetochlor) inorganic salt to verify the effect. The results showed that it lost the function of degrading acetochlor, and named this strain DC-2MUT (CCTCC NO: M2013164).

[0042] 1.2 Extraction of bacterial genome total DNA

[0043] After...

Embodiment 2

[0061] Example 2 Oxygenase gene caceO function verification technology roadmap (strategy map see figure 2 )

[0062] 2.1 Genomic DNA extraction of strain DC-2

[0063] Same as 1.1

[0064] 2.2 PCR amplification of 1.2K nucleic acid fragment containing caceO gene

[0065] With forward primer: 5- CGGGATCCCG GCCAGTTCCGCCGCCCCAAAATCCA (SEQ ID NO.3) is underlined as EcoR I restriction site and reverse primer: A2:5- CGGAATTCCG CTACCCCGCCGACACAGCGACGACC (SEQ ID NO.4) underlined BamH I restriction site was used as a primer to amplify 1.2K-caceO from Sphingobium DC-2 (CCTCCNO: M2012190) genomic DNA by PCR.

[0066] Amplification system:

[0067]

[0068] PCR amplification program:

[0069] a. Denaturation at 98°C for 1 min;

[0070] b. Denaturation at 98°C for 15s, annealing at 53°C for 15s, extension at 72°C for 70s, and 30 cycles;

[0071] c. Extend at 72°C for 10 minutes and cool to room temperature.

[0072] 2.3 The PCR product was double digested with BamH I and Eco...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Disclosed is an oxygenase gene caceO and encoded protein and use thereof, the oxygenase gene caceO sequence being represented as SEQ ID NO.1, and the encoded product CaceO sequence being represented as SEQ ID NO.2. Also disclosed is the use of the oxygenase gene caceO in degrading and converting chloroacetamide herbicide and constructing transgenic crops, and the use of oxygenase CaceO in degrading chloroacetamide herbicide and removing residual chloroacetamide herbicide.

Description

technical field [0001] The invention belongs to the fields of applied environmental microbes and agriculture, and relates to an oxygenase gene caceO and its encoded protein and application. Background technique [0002] While the use of herbicides reduces agricultural labor intensity and ensures normal agricultural production, its residues also cause serious crop damage. According to statistics, the area of ​​herbicide damage in my country's farmland reaches 30 million mu every year, of which serious damage The area reaches 5 million mu, causing losses of several billion yuan every year, and herbicide-resistant genetic modification is the best way to solve herbicide damage. Chloroacetamide herbicides are a kind of highly efficient and highly selective contact herbicides, which have a very significant killing effect on grass weeds. Chloroamide herbicides are currently one of the most widely used herbicides in the world. By 2007, the annual output and area of ​​use were second...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/53C12N9/02C12N15/70C12N1/21A62D3/02B09C1/10C02F3/00C12R1/19C12R1/01A62D101/04A62D101/28C02F101/38
CPCA62D2101/22A62D2101/04C12N9/0004A62D3/02A62D2101/28
Inventor 何健陈青李怡闫新蒋建东洪青黄星李顺鹏朱建春
Owner NANJING AGRICULTURAL UNIVERSITY