Oxygenase gene caceO as well as coded protein and application of oxygenase gene
A gene coding, oxygenase technology, applied in the field of applied environmental microorganisms and agriculture, can solve problems such as phytotoxicity, agricultural loss, crop phytotoxicity, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Embodiment 1. Cloning of acetochlor degradation gene (strategy diagram sees figure 1 )
[0040] 1.1 Obtaining of Mutant Strain DC-2MUT
[0041] At room temperature, the water solubility of acetochlor is 225mg / kg, so the LB plate containing 400mg / kg acetochlor is turbid. Acetochlor) will appear in a transparent circle when incubated at 30°C, and the degradation of acetochlor can be easily judged by naked eyes. However, after many passages, it was found that a colony did not produce a transparent circle around it. Select this colony and put it into 100ml LB liquid medium. After the strain is cultivated to the late logarithmic period, wash it twice with 6,000 centrifuged distilled water, and resuspend it to 20ml (containing 100mg / kg acetochlor) inorganic salt to verify the effect. The results showed that it lost the function of degrading acetochlor, and named this strain DC-2MUT (CCTCC NO: M2013164).
[0042] 1.2 Extraction of bacterial genome total DNA
[0043] After...
Embodiment 2
[0061] Example 2 Oxygenase gene caceO function verification technology roadmap (strategy map see figure 2 )
[0062] 2.1 Genomic DNA extraction of strain DC-2
[0063] Same as 1.1
[0064] 2.2 PCR amplification of 1.2K nucleic acid fragment containing caceO gene
[0065] With forward primer: 5- CGGGATCCCG GCCAGTTCCGCCGCCCCAAAATCCA (SEQ ID NO.3) is underlined as EcoR I restriction site and reverse primer: A2:5- CGGAATTCCG CTACCCCGCCGACACAGCGACGACC (SEQ ID NO.4) underlined BamH I restriction site was used as a primer to amplify 1.2K-caceO from Sphingobium DC-2 (CCTCCNO: M2012190) genomic DNA by PCR.
[0066] Amplification system:
[0067]
[0068] PCR amplification program:
[0069] a. Denaturation at 98°C for 1 min;
[0070] b. Denaturation at 98°C for 15s, annealing at 53°C for 15s, extension at 72°C for 70s, and 30 cycles;
[0071] c. Extend at 72°C for 10 minutes and cool to room temperature.
[0072] 2.3 The PCR product was double digested with BamH I and Eco...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 