Unlock instant, AI-driven research and patent intelligence for your innovation.

Infectious clone vector and application of genetype 7 hepatitis G virus gene

An infectious cloning and hepatitis virus technology, applied in the field of molecular biology, can solve the problems of no GBV-C in vitro culture system, unclear interaction mechanism, and large limitations.

Inactive Publication Date: 2013-08-21
KUNMING UNIV OF SCI & TECH
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] So far, the interaction mechanism between GBV-C and HIV is not clear, and the research methods mostly use GBV-C partial short peptides to study at the cellular level. This method is limited and the research value is not obvious
The main bottleneck is that there is no better GBV-C in vitro culture system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Infectious clone vector and application of genetype 7 hepatitis G virus gene
  • Infectious clone vector and application of genetype 7 hepatitis G virus gene
  • Infectious clone vector and application of genetype 7 hepatitis G virus gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0103] Example 1: Extraction of viral RNA in the plasma of genotype 7 GBV-C infected persons

[0104] The extraction of viral RNA was carried out with reference to the instructions of the Highpure Viral Nueleie Aeid Kit (Roche, Germany), and the specific steps were as follows:

[0105] (1) Add 200 μl of binding buffer (poly A carrier RNA added) and 50 μl of proteinase K to 200 μl of plasma, mix immediately, keep warm in a water bath at 72°C for 10 minutes, then add 100 μl of binding buffer and mix well;

[0106] (2) Assemble the high-purity extraction column and collection tube together, add the sample treated in the previous step to the high-purity extraction column, and centrifuge at 8000g for 1 min;

[0107] (3) Discard the collection tube and waste liquid, put the high-purity extraction column into a new collection tube, add 500 μl inhibitor removal buffer to the extraction column, and centrifuge at 8000 g for 1 min;

[0108] (4) Discard the collection tube and waste liqu...

Embodiment 2

[0113] Embodiment 2: the synthesis of GBV-C cDNA

[0114] (1) Add 2 μl Random Primers (500 μg / ml, Promega) to the PCR reaction tube, then add 10 μl RNA solution, mix well, and then bathe in 95°C water for 5 minutes, then immediately ice-bath for 3 minutes;

[0115] (2) Add 4 μl of 5×RT Buffer, 2 μl of dNTP Mixture (10 mM each), 8 μl of reaction solution containing 20 U of AMV reverse transcriptase and 20 U of RNase inhibitor to the reaction tube, and mix slowly;

[0116] (3) Perform reverse transcription on a PCR machine, the program is: 37°C for 60 min, 95°C for 5 min.

[0117] High-quality cDNA was prepared by RNA reverse transcription, which provided a template for subsequent PCR reactions.

Embodiment 3

[0118] Embodiment 3: 13 fragment PCR reactions of GBV-C

[0119] This amplification adopts nested PCR technology, which is characterized by two rounds of PCR reactions, in which the first round of PCR products are used as templates for the second round of PCR, and the primer sequences and amplified fragment sizes of the 13 amplified fragments are as follows:

[0120] Fragment one:

[0121] 01F1: CTGAATTC GACGTGGGGGGGTTGATC

[0122] 01R1: CCACTGGTCCTTGTCAACTCG

[0123] 01R2: CAAGAGAGACATTGAAGGGCGAC

[0124] The size of the amplified fragment is: 229bp;

[0125] Fragment two:

[0126] 02F1: GGTTGGTAGGTCGTAAATCCCG

[0127] 02R1: AATGCCACCCGCCCTCA

[0128] 02F2: GTAGGTCGTAAATCCCGGTCA

[0129] 02R2: CGAAGGTTCTTGGGCTACC

[0130] The size of the amplified fragment is: 378bp;

[0131] Fragment three:

[0132] 03F1: TCCACGTCGCCCTTCAATGT

[0133] 03R1: GGAAGCAAACCAAGACACGGATC

[0134] 03F2: CGTCGCCCTTCAATGTCTCTCTT

[0135] 03R2: CCACTGATTTTGTCCGTGGCTC

[0136] The size of t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a infectious clone vector of genetype 7 hepatitis G virus gene. According to the invention, thirteen PCR amplified fragments of GBV genetype 7 complete genome are obtained by nest PCR. Overlapping PCR technology is adopted to perform four rounds of overlapping PCR reaction. Fragment assembly is performed on the thirteen fragments successively to obtain GBV genetype 7 complete genome clone. The full-length clone is under double enzyme digestion of EcoRI and XbaI and then connected into the corresponding restriction enzyme sites of phagemid vector pBluescriptII(SK+) to obtain a recombinant plasmid PGBV-C7 containing GBV-C genetype 7 complete genome clone. By the use of the infectious clone vector, hepatitis G virus gene can be produced in PBMC cells of normal people, and then the dynamic growth curve is drawn. The infectious clone vector provided by the invention lays a foundation for the biological characteristics research of GBV-C 7 type and provides necessary tools for the further research of action mechanism between GBV-C and HIV-1.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to an infectious cloning carrier of genotype 7 hepatitis G virus gene and its application in preparing hepatitis G virus in vitro. Background technique [0002] Hepatitis G virus (GB virus C, GBV-C) was discovered in the mid-1990s and belongs to the Flaviviridae family. It is a single-stranded positive-sense RNA virus with a genome length of about 9.4kb. The biggest feature of hepatitis G virus is that it is not pathogenic, but in patients co-infected with HIV, the existence of GBV-C is beneficial to the disease process of HIV patients, that is, delaying the course of HIV patients, prolonging the life span of HIV patients and reducing Mortality, specifically, in patients with GBV-C and HIV co-infection, compared with HIV mono-infection patients, the number of CD4 cells was significantly increased and the viral load of HIV was significantly decreased. Ho...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/63C12N7/00C12R1/93
Inventor 冯悦夏雪山赵文华刘丽张阿梅
Owner KUNMING UNIV OF SCI & TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com