Biosensor construction and detection method based on molecular motor, magnetic enrichment and double-probe hybridization

A molecular motor, biotin technology, applied in biochemical equipment and methods, biological testing, microbial determination/inspection, etc., can solve problems such as inability to detect multiple times, unfavorable comparisons, and limited detection sensitivity.

Inactive Publication Date: 2013-09-18
INSITUTE OF BIOPHYSICS CHINESE ACADEMY OF SCIENCES
View PDF7 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these signal output systems are all instantaneous signal output, the signal molecule and the reaction system cannot be separated, and the detection signal must be detected immediately after the reaction, and the same signal cannot be detected multiple times, so the detection sensitivity is limited, and there is no Facilitate comparisons between samples at different times

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Biosensor construction and detection method based on molecular motor, magnetic enrichment and double-probe hybridization
  • Biosensor construction and detection method based on molecular motor, magnetic enrichment and double-probe hybridization
  • Biosensor construction and detection method based on molecular motor, magnetic enrichment and double-probe hybridization

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1, the general method of detection biomacromolecule

[0039]1. Preparation of ATP molecular motor:

[0040] Thermomicrobium roseum strains (ATCC27502, purchased from ATCC Species Bank, USA) were inoculated into liquid medium (see Table 1) at a ratio of 1:100, and cultured at 60° C. and 150 rpm for 24 hours. Then 4000rpm, 30min, 4 ℃ centrifugation to collect bacteria. With extraction buffer (20mM Tris-ClpH8.0, 100mM NaCl, 2mM MgCl 2 , 1 mM DTT) to resuspend the cells, and centrifuge to remove the supernatant (6000 rpm, 10 min, 4°C). Add extraction buffer to resuspend the cells (approximately 1 g of cells was added to 10 ml of buffer), then add PMSF at a final concentration of 1 mM, and sonicate for 30 min on ice (sonication for 5 s, stop for 8 s, power 300 W). Centrifuge the broken cells (25,000g, 30min, 4°C), remove the precipitate and get the supernatant. The supernatant was ultracentrifuged (145,000g, 1h, 4°C), and the precipitate was obtained as a chro...

Embodiment 2

[0075] Example 2, taking C-reactive protein (CRP) as an example to detect protein molecules

[0076] 1. Prepare the chromophore according to the method described in Example 1.

[0077] 2. Preparation of capture antibody and detection antibody: the C-reactive protein (CRP) used was purchased from meridian lifescience (A97201H). The capture antibody used is CRP monoclonal antibody M86842M (meridianlifescience), and the detection antibody used is CRP monoclonal antibody M86284M (meridianlifescience). The biotinylation process is as follows: add 2μl (+)-BiotinN-hydroxysuccinimide ester (10mM) (sigma, product number H1759) to 200μl CRP capture antibody M86842M (5mg / ml) and CRP detection antibody M86284M (7.5mg / ml) respectively , incubated at room temperature for 4 hours, free (+)-Biotin N-hydroxysuccinimide ester was removed by PBS dialysis, and the dialysate (PBS) was changed three times, each dialysis was 8 hours. The dialyzed biotinylated antibody was collected and added with ...

Embodiment 3

[0091] Example 3. Taking miR141 as an example to detect nucleic acids at different concentrations

[0092] A microRNA (miR141) is used as a target nucleic acid molecule for detection.

[0093] 1. Prepare the chromophore according to the method described in Example 1.

[0094] 2. Preparation of miR141 capture probe and detection probe:

[0095] miR141 (the sequence of miR141 is: UAACACUGUCUGGUAAAGAUGG) was synthesized as a standard sequence at Shanghai Jima Biological Co., Ltd., and diluted to 20uM with diethyl pyrocarbonate (0.1% in DEPC water) as a storage solution. Before the experiment, the storage solution was diluted with DEPC water Diluted into different concentrations (respectively 0, 1nM, 5nM, 10nM, 20nM, 40nM).

[0096] Synthesis of biotinylated capture probes and detection probes (Shanghai Gemma Biological Co., Ltd.):

[0097] Capture probe miRNA141-1: biotin-AAAAAAAAAA CCATTCTTTACC

[0098] Detection probe miRNA141-2: AGACAGTGTTA AAAAAAAAAAA-biotin

[0099]...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a detection method of biomacromolecule, and in particular relates to a method for detecting the biomacromolecule by utilizing the signal amplification characteristic of the ATP molecular motor in terms of time and space and high temperature resistance thereof, high specificity of double-antibody hybridization and double-probe hybridization, high flexibility and fastness of magnetic enrichment and magnetic separation, and the high flexibility of the chemiluminiscence detection technology, and reduction of the non-specific hybridization by the single-stranded nuclease degradation and mismatched double-strand. A novel biosensor construction and detection method is capable of separating the signal molecule from the reaction system, storing the signal molecule to measure for multiple times and facilitating the comparison of the samples in different batches, and according to the method, the super-flexibility, fastness, high specificity and avoidance of amplification can be realized.

Description

technical field [0001] The invention relates to a detection method of biological macromolecules. In particular, it relates to a method for detecting biomacromolecules with high sensitivity using ATP molecular motors, dual-probe hybridization, magnetic enrichment and separation, and chemiluminescent detection techniques. Background technique [0002] A biosensor is a device that uses a combination of biological elements and physical and chemical detection elements to detect an analyte. The double-antibody sandwich method is one of the traditional biomacromolecule detection methods. Its basic principle is to use a pair of specific probes (antibodies or nucleic acids) that can recognize different epitopes of the same molecule to detect through different signal output systems. For the detection of protein macromolecules, the commonly used method is enzyme-linked immunosorbent assay based on antigen-antibody binding. For nucleic acid macromolecules (including DNA, RNA, microRNA,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): G01N33/68C12Q1/68
Inventor乐加昌王佩荣张旭
OwnerINSITUTE OF BIOPHYSICS CHINESE ACADEMY OF SCIENCES