LAMP detection primer, kit and detection method for staphylococcus aureus containing internal standard

A detection kit and staphylococcus technology, applied in the field of molecular biology, can solve problems such as lack of detection conditions in grass-roots detection units, uncontrolled false negative test results, harm of staphylococcus aureus, etc., and achieve the probability of primer dimer Low cost, low cost, high sensitivity effect

Active Publication Date: 2013-10-23
XIAMEN YINXIANG GROUP
View PDF3 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The antibody-based ELISA method and immunofluorescence labeling method shorten the detection time by half, and have high sensitivity but poor specificity; nucleic acid-based PCR technology has been widely used for Staphylococcus aureus due to its sensitivity, simplicity, rapidity and specificity. Detection, but the detection sample is complicated, there is no control over the false negative detection results, and there is a possibility of missed detection
Due to the serious harm of Staphylococcus aureus, the harm caused by missed detection is immeasurable
However, PCR amplification requires expensive instruments, and many grassroots testing units do not have the corresponding testing conditions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP detection primer, kit and detection method for staphylococcus aureus containing internal standard
  • LAMP detection primer, kit and detection method for staphylococcus aureus containing internal standard
  • LAMP detection primer, kit and detection method for staphylococcus aureus containing internal standard

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] The establishment of embodiment 1 Staphylococcus aureus LAMP detection kit

[0060] LAMP detection kit for Staphylococcus aureus, including LAMP primer set, LAMP reaction solution, Bst DNA polymerase, positive control, negative control and internal standard.

[0061] (1) LAMP primer set: using Staphylococcus aureus nuc as the target gene and femA2 as the internal standard gene, the online design software Primer Explorer version 4 (http: / / primerexplorer.jp / e) was used to design LAMP primers.

[0062] The nuc primer sequence is as follows:

[0063] SAnuc-F3: ACAAACAGATAACGGCGTAA (SEQ ID NO: 1);

[0064] SAnuc-B3:CCAAGCCTTGACGAACTAA (SEQ ID NO: 2);

[0065] SAnuc-FIP: AGGATGCTTTGTTTCAGGTGTAAGCGATTGATGGTGATACG (SEQ ID NO: 3);

[0066] SAnuc-BIP: GCCCTGAAGCAAGTGCATTTACGCATAAATACGCTAAGCCAC (SEQ ID NO: 4);

[0067] SAnuc-LF: TCTGAATGTCATTGGTTGACCT (SEQ ID NO: 5);

[0068] SAnuc-LB: GAAGTCGAGTTTGACAAAGGTC (SEQ ID NO: 6).

[0069] The femA2 internal standard primer set is ...

Embodiment 2

[0088] Embodiment 2 Sensitivity experiment

[0089] The constructed plasmid was subjected to a sensitivity experiment, and the 1pg / μl plasmid was diluted 10-fold, and four gradients of 1pg / μl, 100fg / μl, 10fg / μl, and 1fg / μl were used as quality control standards, and the operation of Example 1 was used for detection , determine the minimum detection limit of the internal standard gene by sensitivity experiment 10fg / μl (such as figure 1 Shown), the concentration of the internal standard is positioned at the concentration of the lowest detection limit ( figure 2 ).

[0090] Cultivate the cultivated Staphylococcus aureus, carry out 10-fold gradient dilution of the cultured bacteria, extract DNA according to the method in Example 1, and carry out plate culture counting of the diluted bacterial solution at the same time, and compare the plate culture counting results with this reagent Compared with the lowest sensitivity of the kit, the lowest detection degree of this kit is 10 3 ...

Embodiment 3

[0091] Embodiment 3 specificity experiment

[0092] Using the method of Example 1 to culture Listeria monocytogenes, Salmonella, Escherichia coli O157, Enterobacter sakazakii, Pseudomonas aeruginosa, Escherichia coli, Vibrio parahaemolyticus, Vibrio vulnificus, Shigella baumannii respectively Bacillus sonnei, Shigella sonnei, Proteus vulgaris, Proteus mirabilis, Klebsiella, Micrococcus luteus were extracted, and detected according to Example 1, the results showed that the positive control internal standard gene amplification was normal , against Listeria monocytogenes, Salmonella, Escherichia coli O157, Enterobacter sakazakii, Pseudomonas aeruginosa, Escherichia coli, Vibrio parahaemolyticus, Vibrio vulnificus, Shigella baumannii, Shigella sonnei Proteus vulgaris, Proteus mirabilis, Klebsiella and Micrococcus luteus had no non-specific amplification.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a LAMP detection primer, kit and detection method for staphylococcus aureus containing an internal standard. The primer is shown as SEQ ID NO 1-SEQ ID NO 12, and comprises a detection primer group and an internal standard primer group; and the detection kit comprises a primer group, a reaction solution, a DNA polymerase, positive control and an internal standard. According to the detection method, a sample to be detected is extracted, and a sample template is subjected to amplification for 45-60 minutes at the temperature of 63-65 DEG C, so that whether the sample to be detected contains the staphylococcus aureus can be detected, and whether a false negative detection result exists can be judged according to the fact that whether the internal standard primer group is subjected to amplification. The LAMP detection primer has the advantages of high rapidness, high efficiency, easy and convenient operation, high specificity, high sensitivity, suitableness for field detection and the like; and moreover, false negative detection can be effectively avoided, and the LAMP detection primer is suitable for popularization and application.

Description

technical field [0001] The invention belongs to the technical field of molecular biology and relates to a food safety detection method, in particular to a Staphylococcus aureus LAMP detection primer set, a detection kit and a detection method, and the kit can judge whether the detection result is a false negative according to the internal standard detection result . Background technique [0002] Staphylococcus aureus is an important pathogen belonging to the Staphylococcus genus, which is representative of Gram-positive bacteria and can cause many serious infections. [0003] Staphylococcus aureus is ubiquitous in nature, and can be found in air, water, dust, and human and animal excrement, and food is easily contaminated. According to the U.S. Centers for Disease Control and Prevention, infections caused by Staphylococcus aureus account for the second place, second only to E. coli. Staphylococcus aureus enterotoxin is a worldwide health problem. In the United States, food...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/14C12N15/11
Inventor 石磊王珊珊张志刚苏永裕孟赫诚闫鹤
Owner XIAMEN YINXIANG GROUP
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap