LAMP detection primer, kit and detection method for staphylococcus aureus containing internal standard
A detection kit and staphylococcus technology, applied in the field of molecular biology, can solve problems such as lack of detection conditions in grass-roots detection units, uncontrolled false negative test results, harm of staphylococcus aureus, etc., and achieve the probability of primer dimer Low cost, low cost, high sensitivity effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0059] The establishment of embodiment 1 Staphylococcus aureus LAMP detection kit
[0060] LAMP detection kit for Staphylococcus aureus, including LAMP primer set, LAMP reaction solution, Bst DNA polymerase, positive control, negative control and internal standard.
[0061] (1) LAMP primer set: using Staphylococcus aureus nuc as the target gene and femA2 as the internal standard gene, the online design software Primer Explorer version 4 (http: / / primerexplorer.jp / e) was used to design LAMP primers.
[0062] The nuc primer sequence is as follows:
[0063] SAnuc-F3: ACAAACAGATAACGGCGTAA (SEQ ID NO: 1);
[0064] SAnuc-B3:CCAAGCCTTGACGAACTAA (SEQ ID NO: 2);
[0065] SAnuc-FIP: AGGATGCTTTGTTTCAGGTGTAAGCGATTGATGGTGATACG (SEQ ID NO: 3);
[0066] SAnuc-BIP: GCCCTGAAGCAAGTGCATTTACGCATAAATACGCTAAGCCAC (SEQ ID NO: 4);
[0067] SAnuc-LF: TCTGAATGTCATTGGTTGACCT (SEQ ID NO: 5);
[0068] SAnuc-LB: GAAGTCGAGTTTGACAAAGGTC (SEQ ID NO: 6).
[0069] The femA2 internal standard primer set is ...
Embodiment 2
[0088] Embodiment 2 Sensitivity experiment
[0089] The constructed plasmid was subjected to a sensitivity experiment, and the 1pg / μl plasmid was diluted 10-fold, and four gradients of 1pg / μl, 100fg / μl, 10fg / μl, and 1fg / μl were used as quality control standards, and the operation of Example 1 was used for detection , determine the minimum detection limit of the internal standard gene by sensitivity experiment 10fg / μl (such as figure 1 Shown), the concentration of the internal standard is positioned at the concentration of the lowest detection limit ( figure 2 ).
[0090] Cultivate the cultivated Staphylococcus aureus, carry out 10-fold gradient dilution of the cultured bacteria, extract DNA according to the method in Example 1, and carry out plate culture counting of the diluted bacterial solution at the same time, and compare the plate culture counting results with this reagent Compared with the lowest sensitivity of the kit, the lowest detection degree of this kit is 10 3 ...
Embodiment 3
[0091] Embodiment 3 specificity experiment
[0092] Using the method of Example 1 to culture Listeria monocytogenes, Salmonella, Escherichia coli O157, Enterobacter sakazakii, Pseudomonas aeruginosa, Escherichia coli, Vibrio parahaemolyticus, Vibrio vulnificus, Shigella baumannii respectively Bacillus sonnei, Shigella sonnei, Proteus vulgaris, Proteus mirabilis, Klebsiella, Micrococcus luteus were extracted, and detected according to Example 1, the results showed that the positive control internal standard gene amplification was normal , against Listeria monocytogenes, Salmonella, Escherichia coli O157, Enterobacter sakazakii, Pseudomonas aeruginosa, Escherichia coli, Vibrio parahaemolyticus, Vibrio vulnificus, Shigella baumannii, Shigella sonnei Proteus vulgaris, Proteus mirabilis, Klebsiella and Micrococcus luteus had no non-specific amplification.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
