Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Burkholderia cepacia and application thereof

A Burkholderia, onion technology, applied in the direction of application, bacteria, organic fertilizers, etc., can solve complex problems and achieve the effect of improving utilization rate, yield and quality

Inactive Publication Date: 2013-11-20
湖北明达科技有限公司
View PDF4 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The mechanism of bacterial phosphorus dissolution is very complicated. Some bacteria dissolve phosphorus mainly by protons, some mainly by organic acids, while some strains have both mechanisms, and some strains produce other chelating substances during the growth process, thus lead to the dissolution of phosphate rock powder

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Burkholderia cepacia and application thereof
  • Burkholderia cepacia and application thereof
  • Burkholderia cepacia and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] 1. Isolation and purification of efficient phosphorus-solubilizing bacteria Burkholderia cepacia (B.cepacia) pt6

[0025] The Burkholderia cepacia (B. cepacia) pt6 of the present invention is separated from soil by dilution plate method and plate streak method, and the separation method is: screening by using Montina inorganic phosphorus solid medium. Soil samples were collected in Honghu City, Hubei Province, and the sampling time was February 13, 2012. The 5-point sampling method was used to collect appropriate amounts of soil within the range of 10-20cm around and in the center of the plot. Mix well. Indicate the location, time and person of the collection. Weigh 1g of soil sample into 100mL of sterile water, place in a shaker at 30°C at 150r / m for 10min, take 100μL of 10 -2 、10 -3 、10 -4 Spread the dilution on the inorganic phosphorus solid medium plate, and apply three parallels for each gradient. After culturing at 30°C for 7 days, observe whether there is a p...

Embodiment 2

[0028] Example 2 Strain identification of highly efficient phosphorus-solubilizing bacterium Burkholderia cepacia (B.cepacia) pt6

[0029] (1) Microbiological characteristics: On NA medium, the colony of the strain is pale yellow when cultured at 30°C, and off-white on the PDA plate, round, smooth, raised, with neat edges, and 2-4mm in diameter. The bacteria are straight rod-shaped, the size is (0.5~0.7)μm×(1.5~1.8)μm, with clustered flagella, Gram staining is negative, no spores, capsule staining is negative (no capsule), and can use propanediol Salt, citrate, positive for catalase, positive for gelatin liquefaction, unable to hydrolyze starch.

[0030] (2) Molecular biological characteristics (classification and identification)

[0031]The results of the 16s rDNA gene sequence determination of the strain are as follows (SEQ No.1):

[0032] TGCAAGTCGAACGGCAGCACGGGTGCTTGCACCTGGTGGCGAGTGGCGAACGGGT GAGTAATACATCGGAACATGTCCTGTAGTGGGGGATAGCCCGGCGAAAGCCGGATTAAT ACCGCATACGATCTACGGA...

Embodiment 3

[0033] Example 3 Determination of Phosphorus Solubilizing Ability of Efficient Phosphorus Solubilizing Bacteria Burkholderia cepacia (B.cepacia) pt6

[0034] The phosphate-solubilizing ability of phosphate-solubilizing bacteria was measured by Montina inorganic phosphorus liquid medium. First, the Burkholderia cepacia (B. cepacia) pt6 preserved on the slant was inoculated into NB liquid medium as seeds, and incubated at 30°C. , 180r / min constant temperature shaker culture for 12h, then inoculate the cultured bacterial solution into 250mL Erlenmeyer flask containing 100mL Montina inorganic phosphorus liquid medium according to 1% inoculum amount (v / v) to inoculate 1 % sterile NB liquid medium to Montina inorganic phosphorus liquid medium as a blank control, at 30 ° C, 180r / min constant temperature shaker culture 7d.

[0035] The molybdenum-antimony anti-colorimetric method was used to measure the available phosphorus content in the fermentation broth. The higher the available p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses Burkholderia cepacia and an application thereof. A bacterial strain is Burkholderia cepacia pt6, and a preservation number of the bacterial strain is CGMCC No. 7598 (China General Microbiological Culture Collection Center Number 7598). The invention further discloses a microorganism bacterium agent containing the bacterial strain and a preparation method. An experiment indicates that fermentation liquor of the Burkholderia cepacia pt6 contains a large number of phosphate solubilizing bacteria; the phosphate solubilizing bacteria have definite positive effects on soil improvement; and phosphate solubilizing functions of the phosphate solubilizing bacteria have important significance in increasing a use ratio of a phosphate fertilizer, increasing a yield of crop and improving the quality of the crop.

Description

technical field [0001] The invention belongs to the field of phosphorus-dissolving microbial fertilizers. Specifically, the present invention relates to a Burkholderia cepacia bacterium capable of efficiently decomposing phosphorus and its use, and a biological phosphate fertilizer prepared by using the Burkholderia cepacia. Background technique [0002] Phosphorus is the basic constituent element of genetic material DNA and energy material ATP in plant cells, and plays an important role in the whole life process of plants. Phosphorus is one of the essential elements for plant growth and development. High-energy phosphate bonds are energy carriers. Plants Phosphorus must be involved in photosynthesis and biochemical processes in the body. Phosphorus is not only an important material guarantee for agricultural production, but also a non-renewable mineral resource. The mass fraction of total phosphorus in cultivated soil in my country generally varies between 0.2 and 1.1 g / k...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20C05F11/08C05G3/00C12R1/01
Inventor 牛赡光杨光菊田龙军邓松华杨治家
Owner 湖北明达科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com