Burkholderia cepacia and application thereof
A Burkholderia, onion technology, applied in the direction of application, bacteria, organic fertilizers, etc., can solve complex problems and achieve the effect of improving utilization rate, yield and quality
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] 1. Isolation and purification of efficient phosphorus-solubilizing bacteria Burkholderia cepacia (B.cepacia) pt6
[0025] The Burkholderia cepacia (B. cepacia) pt6 of the present invention is separated from soil by dilution plate method and plate streak method, and the separation method is: screening by using Montina inorganic phosphorus solid medium. Soil samples were collected in Honghu City, Hubei Province, and the sampling time was February 13, 2012. The 5-point sampling method was used to collect appropriate amounts of soil within the range of 10-20cm around and in the center of the plot. Mix well. Indicate the location, time and person of the collection. Weigh 1g of soil sample into 100mL of sterile water, place in a shaker at 30°C at 150r / m for 10min, take 100μL of 10 -2 、10 -3 、10 -4 Spread the dilution on the inorganic phosphorus solid medium plate, and apply three parallels for each gradient. After culturing at 30°C for 7 days, observe whether there is a p...
Embodiment 2
[0028] Example 2 Strain identification of highly efficient phosphorus-solubilizing bacterium Burkholderia cepacia (B.cepacia) pt6
[0029] (1) Microbiological characteristics: On NA medium, the colony of the strain is pale yellow when cultured at 30°C, and off-white on the PDA plate, round, smooth, raised, with neat edges, and 2-4mm in diameter. The bacteria are straight rod-shaped, the size is (0.5~0.7)μm×(1.5~1.8)μm, with clustered flagella, Gram staining is negative, no spores, capsule staining is negative (no capsule), and can use propanediol Salt, citrate, positive for catalase, positive for gelatin liquefaction, unable to hydrolyze starch.
[0030] (2) Molecular biological characteristics (classification and identification)
[0031]The results of the 16s rDNA gene sequence determination of the strain are as follows (SEQ No.1):
[0032] TGCAAGTCGAACGGCAGCACGGGTGCTTGCACCTGGTGGCGAGTGGCGAACGGGT GAGTAATACATCGGAACATGTCCTGTAGTGGGGGATAGCCCGGCGAAAGCCGGATTAAT ACCGCATACGATCTACGGA...
Embodiment 3
[0033] Example 3 Determination of Phosphorus Solubilizing Ability of Efficient Phosphorus Solubilizing Bacteria Burkholderia cepacia (B.cepacia) pt6
[0034] The phosphate-solubilizing ability of phosphate-solubilizing bacteria was measured by Montina inorganic phosphorus liquid medium. First, the Burkholderia cepacia (B. cepacia) pt6 preserved on the slant was inoculated into NB liquid medium as seeds, and incubated at 30°C. , 180r / min constant temperature shaker culture for 12h, then inoculate the cultured bacterial solution into 250mL Erlenmeyer flask containing 100mL Montina inorganic phosphorus liquid medium according to 1% inoculum amount (v / v) to inoculate 1 % sterile NB liquid medium to Montina inorganic phosphorus liquid medium as a blank control, at 30 ° C, 180r / min constant temperature shaker culture 7d.
[0035] The molybdenum-antimony anti-colorimetric method was used to measure the available phosphorus content in the fermentation broth. The higher the available p...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
