Unlock instant, AI-driven research and patent intelligence for your innovation.

Molecular detection method for rapidly differentiating mating type of Villosiclavavirens

A technology for the detection of rice smut bacteria and molecules, which is applied in the direction of microorganism-based methods, microorganism measurement/inspection, biochemical equipment and methods, etc., can solve the problems of cumbersome detection steps, achieve reduced detection steps, convenient and faster methods, The effect of saving testing cost

Inactive Publication Date: 2013-12-11
JIANGSU ACADEMY OF AGRICULTURAL SCIENCES
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to: in view of the defects that the current method for detecting the mating type of rice false smut is necessary to pass two PCR amplifications, and the detection steps are relatively cumbersome, the present invention provides a faster and easier-to-operate method for detecting the mating type of rice false smut Molecular detection method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular detection method for rapidly differentiating mating type of Villosiclavavirens
  • Molecular detection method for rapidly differentiating mating type of Villosiclavavirens
  • Molecular detection method for rapidly differentiating mating type of Villosiclavavirens

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0015] Clone acquisition mat1-2-1 Partial DNA sequence:

[0016] According to the Aspergillus oryzae bacteria amplified by Yokoyama et al. mat1-2-1 Gene 210bp DNA sequence (Genbank accession number: AB124632), design specific nested primers, they are:

[0017] SEQ ID NO.5:

[0018] M2W1: 5’-CAAAGAGGCGAATCCAGGA-3’

[0019] SEQ ID NO.6:

[0020] M2W2: 5’-CTGGGCCGAGCATGGAACCTTGA-3’

[0021] SEQ ID NO.7:

[0022] M2W3: 5’-ACAGGATCAAGCAGGCCCTCTT-3’

[0023] DNA Walking SpeedUp kit (Seegene) was used to amplify the 5’ end DNA sequence of the sequence and sequenced to obtain a total of 526 bp mat1-2-1 Partial DNA sequence of gene

[0024] SEQ ID NO.8:

[0025] mat1-2-1 Partial DNA sequence of gene

[0026] ccgctgtcct tgttagcttc gggatccatt ggacagggtg ccgtcgatgc ctggacgggc 60

[0027] agacagccgt gtggtggtgc tgcgtaccgt ttgcatcccc agcttggcgt gttttatttt 120

[0028] tgcgtctttc ttcggcttcc cggccgcctc agtttgcgtc gtgggtgctg ggcggactgg 180

[0029] ctgtgagggg gattccgctt tcgggggacg agatggggaa gtcgtcggcg gtggat...

Embodiment 2

[0036] Mating type gene mat1-1-1 Partial DNA sequence (Genbank accession number: JQ844754 ) Design primer pairs:

[0037] SEQ ID NO.1:

[0038] Vm1-F: 5’-GAAGTCGTATGCGTGCGAC-3’

[0039] SEQ ID NO.2:

[0040] Vm1-R: 5’-CTTGTTCCACAGGGTGGTCA-3’

[0041] The mating type gene of Aspergillus oryzae obtained according to Example 1 mat1-2-1 Partial DNA sequence (SEQ ID NO.8) design primer pair:

[0042] SEQ ID NO.3:

[0043] Vm2-F: 5’-CAATCTGCGCTTGGGTGTTC-3’

[0044] SEQ ID NO.4:

[0045] Vm2-R: 5’- GGAGCGACATAATACCGTCA -3’.

Embodiment 3

[0047] Using multiplex PCR detection method to determine the mating type of Aspergillus oryzae:

[0048] Collect hyphae and tissue samples to be tested. Including conidia monospora strains, ascospore monospora strains or sclerotia collected in the field.

[0049] CTAB was used to extract the genomic DNA of the required test sample and analyzed by 0.7% agarose gel electrophoresis.

[0050] Using multiple PCR amplification system to detect the mating type of Aspergillus oryzae. The amplification primer pairs are: SEQ ID NO.1 and SEQ ID NO.1; SEQ ID NO.3 and SEQ ID NO.4.

[0051] The multiplex PCR amplification system is: 10×PCR Buffer(Mg 2+ Free), 5uL; MgCl 2 (25mM), 3uL; dNTP Mixture (2.5mM each), 4 uL; template DNA (1-5ng / uL), 1uL; primers Vm1-F, Vm1-R and Vm2-F and Vm2-R, 1 uL each ; Taq DNA polymerase, 0.25uL. The PCR amplification program is: 94°C, 5min; 35×(94°C, 30s; 65.4°C, 30s; 72°C, 30s); 72°C, 5min; 4°C storage.

[0052] Take 5uL PCR amplification product and perform 2% ag...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a molecular detection method for rapidly differentiating the mating type of Villosiclavavirens. The method comprises the following steps: collecting a mycelium for detection and a tissue sample, extracting the genome DNA of samples for detection through adopting a CTAB process, analyzing through using 0.7% agarose gel electrophoresis, carrying out PCR amplification, recording an electrophoresis result through using a gel imaging system, and utilizing markers to determine the size of a DNA fragment. The detection samples in the invention are Villosiclavavirens conidiophore single-spore strains or ascospore single-spore strains or sclerotes, the PCR amplification is multi-PCR amplification, two pairs of amplimers used in a multi-PCR amplification system comprise Vm1-F / Vm1-R and Vm2-F / Vm2-R, Vm1-F is represented by SEQIDNO.1, Vm1-R is represented by SEQIDNO.2, Vm2-F is represented by SEQIDNO.3 and Vm2-R is represented by SEQIDNO.4.

Description

technical field [0001] The invention relates to the field of plant protection, and is a method for quickly distinguishing rice smut bacteria ( Villosiclava virens ) Molecular detection method of mating type. technical background [0002] The mating type of fungi is the genetic basis controlling their mating affinity and sexual reproduction, and homothallic ascomycetes usually have a single mating type locus; whereas most heterothallic filamentous ascomycetes have a pair of highly heterologous mating Type loci. In heterothallic ascomycetes, the heterologous mating-type loci are MAT1-1 and MAT1-2 ,in MAT1-1 Loci contain at least one mating type gene with an α-domain mat1-1-1 ,and MAT1-2 The mating type locus contains at least one mating type gene with a high mobility protein family (HMG) domain mat1-2-1 , by detecting mat1-1-1 and mat1-2-1 Mating type genes determine the mating type of heterothallic ascomycete fungi. [0003] By the rice smut fungus (sexual s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04C12R1/645
Inventor 于俊杰刘永锋尹小乐俞咪娜
Owner JIANGSU ACADEMY OF AGRICULTURAL SCIENCES