Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Nucleic acid detection kit for detecting BRCA1mRNA (breast cancel susceptibility gene1 messenger ribonucleic acid)

A detection kit and nucleic acid technology, applied in the fields of life science and biology, can solve the problems of high cost and inferior specificity, and achieve the effect of reducing detection cost, simple operation and saving detection time.

Active Publication Date: 2013-12-18
杭州艾迪康医学检验中心有限公司
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, because SYBR GreenI is an unsaturated dye, its specificity is not as good as that of the double-probe hybridization method and the Taqman method, and its specificity must be judged by observing the melting curve; and the cost of the double-probe hybridization method is relatively expensive.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid detection kit for detecting BRCA1mRNA (breast cancel susceptibility gene1 messenger ribonucleic acid)
  • Nucleic acid detection kit for detecting BRCA1mRNA (breast cancel susceptibility gene1 messenger ribonucleic acid)
  • Nucleic acid detection kit for detecting BRCA1mRNA (breast cancel susceptibility gene1 messenger ribonucleic acid)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] The nucleic acid detection kit for detecting BRCA1mRNA of the present invention comprises:

[0024] Red blood cell lysate;

[0025] RNA extraction solution: QIAGEN RNeasy FFPE Kit.

[0026] Detection system PCR reaction solution: THUNDERBIRD Probe qPCR Mix (2×) (including PCR buffer, d NTP, Mg 2+ ), BRCA1 primers each 0.8uM, BRCA1-probe (probe) 0.4uM; Actin primers each 0.8uM, Actin-probe (probe) 0.4uM; among them,

[0027] BRCA1-F: CAGCTACCCTTCCATCATAAGTGA,

[0028] BRCA1-R: GGCCATGTATATGCGAATCTTTTT,

[0029] BRCA1-Probe: FAM-TTCTGCCCTTGAGGACCTGCGAAAT-TAMRA,

[0030] Actin-F: TGAGCGAGGCTACAGCTT,

[0031] Actin-R: TCCTTGATGTCGCGCACGATTT,

[0032] Actin-Probe: FAM-ACCACCACGGCCGAGCGG-TAMRA;

[0033] Positive control substance: solution containing BRCA1 genome;

[0034] Negative control substance: no BRCA1 genome solution.

Embodiment 2

[0036] The using method of kit of the present invention:

[0037] (1) Extract tissue RNA from paraffin slices: cut out the tissue or paraffin slice samples and place them in a 1.5ml centrifuge tube (scrape); add 1ml tissue clear solution, shake and mix well, and centrifuge at 13000rpm for 1min; remove the supernatant and add 500ml tissue Centrifuge at 13,000rpm for 1min after shaking and mixing the transparent liquid; remove the supernatant, add 1ml of absolute ethanol, shake and mix, and centrifuge at 13,000rpm for 1min; remove the supernatant and put it in a 37-degree metal bath for 10min (open the cover) until the liquid is dry; refer to QIAGEN RNeasy FFPE Kit paraffin RNA extraction kit instructions, extract sample RNA.

[0038] (2) Refer to the instructions of the Rever Tra Ace qPCR RT Kit kit from TOYOBO to reverse RNA to cDNA.

[0039] (3) Reagent configuration: according to the number of people to be tested, X ul of the PCR reaction solution of the detection system is...

Embodiment 3

[0049] Using the nucleic acid detection method of the present invention to detect clinical specimens

[0050] Take 20 cases of paraffin section specimens from breast cancer patients (using double-tube fluorescent quantitative PCR technology), extract genomic RNA, prepare reagents and detect according to the method described in Example 2.

[0051] Add 2ul of each sample to the detection system PCR reaction solution. At the same time, make a standard curve of positive, negative, blank control, and internal reference gene / target gene. A 96-well fluorescent PCR instrument can detect 20 samples at the same time, each sample has 2 repetitions, a positive control, a negative control and a blank control. The detection time is only 100 minutes.

[0052] The experimental results were compared with the reported results of the PCR group to determine the accuracy of the sample detection. Some positive results are as follows:

[0053] Sample

Internal reference expression

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nucleic acid detection kit for detecting BRCA1mRNA (breast cancel susceptibility gene1 messenger ribonucleic acid). The nucleic acid detection kit comprises red blood cell lysis buffer, RNA extracting solution, detection system PCR (polymerase chain reaction) liquid, a positive reference substance and a negative reference substance. The nucleic acid detection kit is characterized in that the detection system PCR liquid comprises PCR buffer solution, dNTP (diethyl-nitrophenyl thiophosphate), Mg<2+>, upstream and downstream primers BRCA1-F / BRCA1-R and a probe BRCA1-Probe for detection, upstream and downstream primers Actin-F / Actin-R probe Actin-Probe for reference, in which, BRCA1-F:CAGCTACCCTTCCATCATAAGTGA; BRCA1-R:GGCCATGTATATGCGAATCTTTTT; BRCA1-Probe:FAM-TTCTGCCCTTGAGGACCTGCGAAAT-TAMRA; Actin-F:TGAGCGAGGCTACAGCTT; Actin-R:TCCTTGATGTCGCGCACGATTT; Actin-Probe:FAM-ACCACCACGGCCGAGCGG-TAMRA.

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, in particular to a gene detection kit, which can detect the expression level of BRCA1 in human breast cancer by using probe real-time fluorescent quantitative PCR technology, which can effectively save detection time and improve detection precision. Background technique [0002] Breast cancer is a common tumor in women and has become the second leading cause of cancer death. Its diagnosis is mainly based on imaging examinations, lacking laboratory-specific diagnostic indicators, which brings difficulties to early diagnosis and is easy to be missed or misdiagnosed. Surgical resection is the first choice for the treatment of breast cancer, but the shape is affected after surgery, and the appearance is not good. It has caused great distress to patients, and some patients have psychological shadows caused by it, which seriously affects their quality of life. At present, it is generally...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68G01N21/64
Inventor 方国伟周晓犊王淑一
Owner 杭州艾迪康医学检验中心有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com