Application of miR-17-5p and miR-20a in preparation of etoposide drug-resistant reversal agent

A mir-20a, Poside-sensitive technology, applied in anti-tumor drugs, drug combinations, pharmaceutical formulations, etc., can solve the problems of p53 deletion sites, mutations, severe bone marrow suppression, gastrointestinal reactions, liver and kidney damage, etc. Achieve the effect of huge application value, strong operability, and simple and easy technology

Active Publication Date: 2014-01-22
SUN YAT SEN UNIV
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

(3) Deletion or site mutation of p53
Etoposide is widely used in cancer chemotherapy regimens, but due to severe myelosuppression, gastrointestinal tract reactions, and liver and kidney damage in chemotherapy, it needs to be used in combination with other drugs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of miR-17-5p and miR-20a in preparation of etoposide drug-resistant reversal agent
  • Application of miR-17-5p and miR-20a in preparation of etoposide drug-resistant reversal agent
  • Application of miR-17-5p and miR-20a in preparation of etoposide drug-resistant reversal agent

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Differences in sensitivity between K562 cells and HL60 cells to the chemotherapeutic drug etoposide

[0040] Divide K562 cells and HL60 cells into 3×10 5 / mL density was inoculated in 96-well plates, and after 24 hours of culture, 0.1-100 μmol / L etoposide was added to treat for 24 hours (with DMSO as the control), and then the cell viability was detected by MTT. See the experimental results figure 1 A, Etoposide could not effectively reduce the survival rate of K562 cells at each concentration tested, and 100 μmol / L etoposide could only reduce the survival rate of K562 cells by about 10%. On the contrary, the inhibitory effect of etoposide on HL60 cells was positively correlated with the dose of the drug, and 100 μmol / L etoposide could reduce the survival rate of HL60 cells to less than 40%.

[0041] Divide K562 cells and HL60 cells into 3×10 5 / mL density was inoculated in a 48-well plate, and after 24 hours of culture, 10-100 μmol / L etoposide was added ...

Embodiment 2

[0042] Example 2 Expression difference of miR-17-5p, miR-20a and Bim-S protein in K562 cells and HL60 cells

[0043] K562 cells and HL60 cells in logarithmic growth phase were collected, and total RNA was extracted using Trizol Reagent (Invitrogen, USA). The RNA concentration was measured by UV spectrophotometer. Then the extracted total RNA was reverse-transcribed (1 hr at 42 °C, 5 min at 95 °C) and real-time quantitative PCR reaction with miRCURY LNA® Universal RT microRNA PCR (Exiqon, Denmark) kit, and the expression level of U6 snRNA was used as The expression difference of miR-17-5p and miR-20a mature body miRNA in K562 cells and HL60 cells was analyzed by internal control. The results showed that the expression levels of miR-17-5p and miR-20a mature body miRNA in K562 cells were higher than those in HL60 cells, about 3 times that of HL60 cells ( figure 2 A).

[0044] The K562 cells and HL60 cells in the logarithmic growth phase were collected, the total cell protei...

Embodiment 3

[0045] Example 3 Effect of inhibiting miR-17-5p, miR-20a or overexpressing Bim-S on apoptosis

[0046] To study the role of miR-17-5p and miR-20a in apoptosis, we transfected single-chain miR-17-5p or inhibitor of miR-20a into K562 cells using Neon electrotransfection system. After 48 hours, cells were collected to detect cell apoptosis by AnnexinV-FITC / PI staining. Compared with the negative control, inhibitors of miR-17-5p or miR-20a could significantly increase the proportion of K562 cells undergoing apoptosis ( image 3 A).

[0047] In order to study the effect of Bim-S protein on apoptosis, we constructed an expression vector to overexpress Bim-S. First, use the following primers (synthesized by Guangzhou Yingwei Jieji Co., Ltd.) to amplify the Bim cDNA in K562 cells:

[0048] Upstream primer: TTGGATCCCGCCACCATGGCAAAGCAACCTTCTGATG,

[0049] Downstream primer: TTGAATTCTCAATGCATTCTCCACACCAGG.

[0050] The DNA band whose size conforms to Bim-S was recovered from rubbe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a new method for diagnosing and reversing drug resistance of tumor cells to etoposide (also known as VP-16 and vepeside) by revealing a mechanism that the tumor cells generate drug resistance to a chemotherapy drug namely the etoposide. By detecting expressions of miRNA and apoptosis-related proteins in the tumor cells with different sensitivities to the etoposide, the inventor discovers that miR-17-5p and miR-20a show low expression in the cells with high sensitivities to the etoposide, but garget gene Bim-S pro-apoptotic proteins of the miR-17-5p and miR-20a show high expression. On the contrary, in the cells with drug resistance to the etoposide, the expression quantities of the miR-17-5p and miR-20a are high, but the Bim-S proteins show low expression. An inhibitor using the miR-17-5p and / or miR-20a can be used for effectively reversing the drug resistance of the tumor cells to the etoposide. The invention provides a brand-new simple and effective method for detection and / or prognosis of drug resistance of cancers to the etoposide, and provides a means of reversing the drug resistance of the tumor cells, which has great potential application values in clinical diagnosis and personalized treatment of tumors.

Description

technical field [0001] The present invention relates to the field of medicine and biology, relates to the diagnosis and treatment of tumor drug resistance, and more specifically relates to predicting the sensitivity and / or tolerance of tumor cells to the chemotherapeutic drug etoposide by detecting the expression of marker microRNA and apoptosis regulatory protein method, and the application of reducing tumor resistance to etoposide by changing the expression of miR-17-5p, miR-20a microRNA and the expression of Bim-S pro-apoptotic protein. Background technique [0002] Chemotherapy is one of the main means of clinical tumor treatment. However, the drug resistance of tumor cells often greatly weakens the efficacy of chemotherapy drugs. As a result, tumor patients are no longer sensitive to drug treatment and lead to tumor recurrence. Therefore, detecting or prognosing the drug resistance of tumor cells to chemotherapy drugs in clinical diagnosis and developing drugs that rev...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K45/00C12Q1/68G01N33/68A61P35/00
Inventor翁桁游黄慧琳周惠屈良鹄
OwnerSUN YAT SEN UNIV