A kind of high temperature resistant neutral cellulase cel61p8 and its gene and application
A neutral cellulase and cellulase technology, applied in the field of genetic engineering, can solve problems such as high price and achieve the effect of good thermal stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0086] Example 1 Cloning of Humicolasp.P8 Cellulase Encoding Gene Cel61P8
[0087] Humicolasp.P8 was isolated from forest soil in Zhangjiakou, Hebei Province.
[0088] Extraction of Humicolasp.P8 genomic DNA:
[0089] Using the CTAB method to extract the fungal genome, see (Grahametal., 1994), with some modifications:
[0090] ① Take about 2 g of the fungal culture by centrifugation, remove the medium as much as possible, and grind it several times in liquid nitrogen;
[0091] ②Add 15-20mL preheated CTAB lysate (generally 0.5-1g plus 3mL), mix well and incubate at 65°C for 2h, and mix well every 15min;
[0092] ③Add an equal volume of Tris-saturated phenol and chloroform mixture, mix well, centrifuge at 12,000g at 4°C for 15min, then transfer the supernatant to a new centrifuge tube (repeat once for the degree of opsin residue);
[0093] ④ Add an equal volume of chloroform to the supernatant, mix well, centrifuge at 12,000g at 4°C for 15min, and transfer the supernatant to ...
Embodiment 2
[0106] The preparation of embodiment 2 recombinant cellulase
[0107] Mature protein expression primers designed to remove the signal peptide (Cel61P8-expF:GGG GAATTC CACGGCCATGTCACCCCACATCGTCATC and Cel61P8-expR:GGG GCGGCCGC TCAAGCAACCACCTGCACACCCTCCCTC), and then amplified to the mature protein gene by RT-PCR. The expression vector pPIC9 was subjected to double digestion (EcoRI+AvrII), and the mature gene Cel61P8 encoding cellulase was double-digested (EcoRI+AvrII), and the gene fragment encoding mature cellulase was cut out and connected to the expression vector pPIC9 to obtain The recombinant plasmid pPIC-cel61P8 containing the Humicolasp.P8 cellulase mature protein gene was transformed into Pichia pastoris GS115 to obtain the recombinant Pichia pastoris strain GS115 / cel61P8. The same method was used to construct the expression vector of the Cel61P8 cellulase full-length gene containing the signal peptide sequence, and obtain the recombinant Pichia pastoris strain.
...
Embodiment 3
[0109] The activity analysis of embodiment 3 recombinant cellulase
[0110] DNS method: The specific method is as follows: at pH 7.0 and 65°C, 1 mL of reaction system includes 100 μL of appropriate diluted enzyme solution, 900 μL of substrate (CMC-Na), reacted for 30 minutes, added 1.5 mL of DNS to terminate the reaction, boiled for 5 minutes . After cooling, the OD value was measured at 540 nm. One enzyme activity unit (U) is defined as the amount of enzyme that releases 1 μmol of reducing sugar per minute under given conditions.
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More