Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Wheat protein TaMYB1, and coding gene and application thereof

A protein and gene technology, applied in the field of wheat protein TaMYB1 and its encoding gene and application, can solve the problems of fast mutation speed, loss of resistance of effective disease resistance genes, etc.

Inactive Publication Date: 2014-02-19
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF3 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because wheat powdery mildew has a large population, a wide range of adaptation, many physiological races, and a fast mutation rate, many effective disease-resistant genes lose resistance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Wheat protein TaMYB1, and coding gene and application thereof
  • Wheat protein TaMYB1, and coding gene and application thereof
  • Wheat protein TaMYB1, and coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Embodiment 1, the acquisition of TaMYB1 gene

[0050] 1. Obtaining RNA

[0051] Seven-day-old seedlings of wheat variety Yumai 66 were inoculated with E. tritici physiological race E09, collected for 24 hours, and RNA was extracted.

[0052] 2. Obtain cDNA by reverse transcription

[0053] Reverse transcription system:

[0054] RNA 2.5ul

[0055] Oligo-dT 1ul

[0056] DEPC-H 2 O 6.5ul

[0057] Mix the above solutions in a centrifuge tube, set at 70°C for 5 minutes, and place on ice for another 5 minutes.

[0058]

[0059] Continue to add the above solution into the centrifuge tube, incubate at 48°C for 1 hour, 70°C for 15 minutes, and 4°C for 10 minutes to obtain cDNA.

[0060] 3. Clone TaMYB1

[0061] Add the above cDNA to 25ul ddH 2 0, get 1ul to carry out follow-up PCR reaction as template, carry out PCR amplification with following primers,

[0062] F: AAATTTGGATCCATGTCACGGATCGGAGAT (sequence 3)

[0063] R: GGGCCTGTCGACTTATATTGAGTTACCATCAT (sequence 4)...

Embodiment 2

[0069] Embodiment 2, the application of TaMYB1 gene in powdery mildew resistance

[0070] 1. Preliminary identification of the resistance of TaMYB1 to powdery mildew by gene gun transient overexpression technology

[0071] 1. Carrier Construction

[0072] 1) Using the PCR product obtained in Example 1 (or artificially synthesized sequence 1) as a template, use the following primers F' and R' to perform PCR amplification to obtain a PCR product of about 1.2Kb.

[0073] F': GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGTCACGGATCGGAGAT

[0074] R': GGGGACCACTTTGTACAAGAAAGCTGGGTCTTATATTGAGTTACCATCAT

[0075] 2) Perform BP reaction with the above PCR product and pDNOR201 vector (purchased from Invitrogen Company) to obtain the ENTRY vector.

[0076] The above BP reaction system:

[0077] PCR product 75ng

[0078] pDNOR201 75ng

[0079] BPase 0.5ul

[0080] 25°C overnight.

[0081] 3) Perform LR reaction with the above ENTRY vector and pUBI-Adaptor-NOS vector to generate pUBI-TaMYB1 vec...

Embodiment 3

[0139] Example 3. Analysis of subcellular localization of TaMYB1 and expression pattern induced by powdery mildew

[0140] 1. Subcellular localization of TaMYB1

[0141] 1. Carrier Construction

[0142] 1) Using the PCR product obtained in Example 1 (or artificially synthesized sequence 1) as a template, PCR amplification was performed with the following primers F1 and R1 to obtain a PCR product of about 1.2 Kb.

[0143] F1: GGGGACAAGTTTGTACAAAAAAGCAGGCT-TC-ATGTCACGGATCGGAGAT

[0144] R1: GGGGACCACTTTGTACAAGAAAGCTGGGT-C-TATTGAGTTACCATCATGT

[0145] 2) Perform BP reaction with the above PCR product and pDNOR201 vector (purchased from Invitrogen) to obtain the ENTRY-1 vector.

[0146] The above BP reaction system:

[0147] PCR product 75ng

[0148] pDNOR201 75ng

[0149] BPase 0.5ul

[0150] 25°C overnight.

[0151] 3) React the above ENTRY-1 vector with pUbi-Gateway-eYFP vector LR to generate pUBI-TaMYB1-mYFP vector.

[0152] LR reaction system:

[0153] Intermediate ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a wheat protein TaMYB1 and a coding gene and application thereof. The protein provided by the invention is shown in (a) or (b), wherein (a) refers to a protein composed of an amino acid sequence shown in a sequence 2 in a sequence table, and (b) refers to a protein which is related to disease resistance or has transcription activation activity and is derived from the sequence 2 through substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence shown in the sequence 2 in the sequence table. Experimental results in the invention show that the protein TaMYB1 can resist diseases caused by Blumeria graminis f.sp.tritici physiological race E09 or Blumeria graminis f.sp.hordei after transient expression of the protein, has transcription activation activity and can be used as a transcription activating factor. Research in the invention shows that the protein lays a foundation for research on cultivation of a transgenic plant with disease resistance.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a wheat protein TaMYB1 and its coding gene and application. Background technique [0002] Wheat powdery mildew (Powdery mildew) is a fungal disease caused by the obligate parasitic fungus Powdery mildew Bgt (Blumeria graminis f sp. tritici). It is a worldwide distribution disease and seriously affects the world's wheat production. In recent years, due to the increase of crop planting density, the increase of nitrogen fertilizer application, and the single planting of crops, the damage caused by wheat powdery mildew has become increasingly serious. After the wheat is damaged, it can lead to early withering of leaves, reduced photosynthesis, enhanced respiration, reduced number of tillers, reduced ear formation rate, and reduced dry grain weight. Generally, the yield can be reduced by 5% to 10%, and the yield of severely diseased fields can be reduced by more than 20%. Because wheat p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/29C12N15/63C12N5/10C12N15/11C12N15/82A01H5/00
CPCC07K14/415C12N15/8282
Inventor 荆邵娟常诚沈前华于德水
Owner INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com