SNP (single nucleotide polymorphism) genotyping method and application thereof

A single nucleotide polymorphism and typing method technology, applied in the field of single nucleotide polymorphism typing, can solve the problems of high cost and popular application, high reagent requirements, low degree of automation, etc., and achieve high accuracy , cost reduction, high degree of mechanization effect

Inactive Publication Date: 2014-02-19
INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This development process requires the detection of many endonucleases, which is costly and labor-intensive, and the detection process requires the use of electrophoresis technology with low automation and low throughput; high resolution melting curve analysis (high resolution melting curve analysis) A new technology developed for mutation scanning and genotyping, but it is not easy to popularize because of the need to use saturated fluorescent dyes such as LC Green, EvaGreen or Syto9, high requirements for reagents, and high cost. application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SNP (single nucleotide polymorphism) genotyping method and application thereof
  • SNP (single nucleotide polymorphism) genotyping method and application thereof
  • SNP (single nucleotide polymorphism) genotyping method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Example 1: Taking cabbage as an example, 4 SNP sites were randomly selected in the whole genome, and the CAPS-MC technology was used to detect 3 genotypes

[0057] (1) Analysis of SNP sites

[0058] Analyze the SNP variation sites of the two parental Dicer recognition sequences of the parent 'L58' (Chinese cabbage) and the parent 'ZCT095' (Laver stalk), using the published Chinese cabbage genome reference sequence as a bridge, through the parent 'L58' (Chinese cabbage) The resequencing data were compared with the cabbage reference genome sequence, and the SNP variation sites between the two were extracted; the resequencing data of another parent 'ZCT095' (Laver stalk) was compared to the extracted SNP site; the parent 'ZCT095 The sites identical to the reference genome sequence were considered to be polymorphic sites between the parent 'ZCT095' and the parent 'L58'.

[0059] Similarly, by comparing the resequencing data of the parent 'ZCT095' with the reference genome ...

Embodiment 2

[0092] Example 2: Taking the plant kale as an example, the application of this technology to screen male sterile individual plants in the kale BC7 population

[0093] (1) Analysis of SNP sites and conversion into CAPS-MC markers

[0094] Based on the resequencing data of the parents "kale M1" and "kale M2", predict the SNP site of the restriction endonuclease AluI recognition base sequence (AGC^T), take one of the SNP sites as an example, and Transformed into CAPS-MC markers, 8 lines were randomly selected from the population for SNP detection. The sequence of the forward primer of this marker is (5’-3’) TCTAACGCATGTAATGATTTCACAT; the sequence of the reverse primer is (5’-3’) AACCTTAAACACAAATCCAAATTTA. The size of the PCR target fragment is 175bp, and the size after AluI digestion is 90bp and 85bp.

[0095] (2) PCR amplification and digestion

[0096] Genomic DNA of 8 selected strains were extracted respectively, and PCR amplification was carried out using labeled primers. ...

Embodiment 3

[0101] Example 3: Taking tomato as an example, the detection of the SNP site of the X gene.

[0102] (1) SNP site analysis and conversion into CAPS-MC markers

[0103] Such as Figure 5 As shown, there is a SNP (T136G) polymorphism in the 136bp of the tomato X gene. Search the restriction endonuclease site according to the polymorphic sequence, and find that the polymorphic site is located in the base recognized by the endonuclease HpyCH4IV (A^CGT). When the SNP site is G, it can be cut by the enzyme , if the SNP site is T, it cannot be cut by the enzyme. For the upstream and downstream sequences of this site, CAPS-MC markers were developed, and forward and reverse primers (5'-3') were designed: AATTTCTGATTCCACCATTGC, AAGCCCTACGTCAAAGACCA. The size of the PCR target fragment is 232bp, and the size after HpyCH4IV digestion is 134bp and 98bp.

[0104] (2) PCR amplification and digestion

[0105] The genomic DNA of the 6 samples to be tested was extracted respectively, and P...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an SNP (single nucleotide polymorphism) genotyping method and an application thereof, and relates to an SNP genotyping method. The SNP genotyping method is an SNP genotyping technology based on the combination of restriction endonuclease fragment length polymorphism (RFLP) and a melting curve. The method is high in accuracy, good in stability, fast, time-saving, high-throughput and safe, facilitates automatic operation and doesn't require gel electrophoresis, the operation process produces no harm to a human body, and the cost is low. The SNP genotyping method not only gains a great success in the aspects of plant SNP genotyping and breeding of Chinese cabbage, Chinese kale, tomatoes and the like, but also has a great application value in the aspects of establishment of a high-precision genetic map, fine mapping of genes, genome-wide association analysis, establishment of a phylogenetic tree and the like in biology.

Description

technical field [0001] The invention belongs to the technical field of molecular genetic markers, relates to the screening and detection of genetic molecular markers, in particular to a single nucleotide polymorphism typing method and its application. Background technique [0002] Molecular markers are genetic markers based on nucleotide sequence variation in genetic material between individuals, and are a direct reflection of genetic polymorphism at the DNA level. With the development of molecular biology technology, DNA molecular marker technology has also developed rapidly. At present, a large number of molecular markers have been developed, such as SSR, AFLP, and Indel markers. Map bit cloning and other aspects have made great contributions. [0003] A single nucleotide polymorphism (SNP) mainly refers to a single nucleotide transition (ie, the substitution of one pyrimidine for another or the substitution of one purine for another) or transversion (ie, the exchange of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6895C12Q1/686C12Q2527/107C12Q2563/107C12Q2600/156
Inventor王晓武程锋武剑梁建丽李平霞刘博
OwnerINST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI