Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer and method for detecting leukemia BCR/ABL b3a2 and b2a2 fusion gene relative transcript level

A relative expression level and fusion gene technology, which is applied in the field of primers and methods for detecting the relative expression level of leukemia BCR/ABL b3a2, b2a2 fusion genes, can solve the problems of high cost and poor specificity, and achieve simple operation and low detection cost , the effect of high detection accuracy

Active Publication Date: 2014-03-26
WUHAN ADICON CLINICAL LAB
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, because SYBR GreenI is an unsaturated dye, its specificity is not as good as that of the double-probe hybridization method and the Taqman method, and its specificity must be judged by observing the melting curve; and the cost of the double-probe hybridization method is relatively expensive.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and method for detecting leukemia BCR/ABL b3a2 and b2a2 fusion gene relative transcript level
  • Primer and method for detecting leukemia BCR/ABL b3a2 and b2a2 fusion gene relative transcript level
  • Primer and method for detecting leukemia BCR/ABL b3a2 and b2a2 fusion gene relative transcript level

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] The kit for detecting the relative expression of leukemia BCR / ABL (b3a2, b2a2) fusion gene of the present invention comprises:

[0027] Red blood cell lysate;

[0028] TRIzol;

[0029] Chloroform;

[0030] Anhydrous ethanol;

[0031] ReverTra Ace qPCR RT Kit (TOYOBO);

[0032] Detection system PCR reaction solution: THUNDERBIRD Probe qPCR Mix (2×), b3a2 / b2a2 upstream and downstream primers 0.8uM, b3a2 / b2a2-probe (probe) 0.4uM; abl upstream and downstream primers 0.8uM, abl-probe (probe) 0.4uM; where:

[0033] b3a2-F:GATTTAAGCAGAGTTCA;

[0034] b2a2-F:TGTGTGAAACTCCAGACTGT;

[0035] b3a2 / b2a2-R:TCCTTGGAGTTCCAACGA;

[0036] b3a2 / b2a2-Probe:FAM-AGCCCTTCAGCGGCCAGTAGCATCT-TAMRA;

[0037] abl-F:GCCGTGAAGACCTTGAAGGAG;

[0038] abl-R:ATGATATAGAACGGGGGCTC;

[0039] abl-Probe:FAM-ACCTGGTGCAGCTCCTTGGG-TAMRA

[0040] Positive control substance: respectively containing BCR / ABL (b3a2, b2a2) genome solution;

[0041] Negative control: Genomic solution without BCR / ABL (b3a2,...

Embodiment 2

[0043] The using method of kit of the present invention:

[0044] (1) Extract tissue RNA from blood: Add 1ml of erythrocyte lysate to a clean 1.5ml centrifuge tube, take 0.5ml of anticoagulated blood and mix well. Let stand at room temperature for 10 minutes; centrifuge at 5000rpm for 5min, discard the supernatant, and collect the cells at the bottom; add 0.5ml red blood cell lysate again, centrifuge at 5000rpm for 5min, discard the supernatant, and collect the cells at the bottom; add 1ml TRIzol to the cells, and pipette repeatedly until sedimentation Dissolve completely, let stand at room temperature for 5 minutes; add 0.2ml chloroform, shake evenly; centrifuge at 14000rpm at 4°C for 10 minutes, absorb the supernatant layer and transfer to another new centrifuge tube; add an equal volume of isopropanol, mix well up and down, and let stand at room temperature Centrifuge at 14000rpm at 4°C for 10min, discard the supernatant, add 1ml of 75% ethanol, wash the tube wall upside down...

Embodiment 3

[0054] Using the nucleic acid detection kit of the present invention to detect clinical specimens

[0055] Take 20 cases of anticoagulant blood samples from patients with chronic myeloid leukemia (CML), acute lymphoblastic leukemia (ALL) and a small number of patients with acute myeloid leukemia (AML), extract genomic RNA and prepare reagents according to the method described in Example 2 and detect.

[0056] Add 2ul of each sample to the detection system PCR reaction solution. At the same time, make a standard curve of positive, negative, blank control, and internal reference gene / target gene. A 96-well fluorescent PCR instrument can detect 38 samples at the same time, each sample has 2 repetitions, a positive control, a negative control and a blank control. The detection time is only 100 minutes.

[0057] The experimental results are compared with the results reported by the special inspection laboratory to determine the accuracy of the sample detection. Some positive re...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer for detecting leukemia BCR / ABL fusion gene relative transcript level. The primer comprises (1) upstream and downstream primers b3a2-F, b2a2-F and b3a2 / b2a2-R and a b3a2 / b2a2-probe for detecting target genes, and (2) primers abl-F and abl-R and an abl-probe for detecting reference genes. The invention further discloses a method for detecting the leukemia BCR / ABL fusion gene relative transcript level, the detection accuracy is high, the operation is simple, the detection cost can be reduced, and the detection time is saved.

Description

[0001] This application is a divisional application of the Chinese patent application with the application number 201210126663.9 and the application date on April 25, 2012. technical field [0002] The invention belongs to the field of life science and biotechnology, in particular to a gene detection kit, which adopts probe real-time fluorescent quantitative PCR technology, and can treat human chronic myelogenous leukemia (CML), acute lymphocytic leukemia (ALL) and a small number of acute lymphoblastic leukemia (ALL) Detection of BCR / ABL (b3a2, b2a2) fusion gene expression level in patients with myeloid leukemia (AML) can effectively save detection time and improve detection accuracy. Background technique [0003] Leukemia is a kind of clonal malignant disease with abnormal hematopoietic stem cells. The leukemia cells in its clones lose the ability to further differentiate and mature and stagnate at different stages of cell development. In the bone marrow and other hematopo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/686C12Q2561/113C12Q2561/101C12Q2545/114
Inventor 周晓犊王淑一徐建成
Owner WUHAN ADICON CLINICAL LAB