Vegetable oil body gel containing EGF (Epidermal Growth Factor)
A vegetable oil body and gel technology, applied in the biological field, can solve problems such as inconvenient use
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1 The acquisition of safflower EGF transgenic seeds
[0037] According to the Chinese patent ZL 200610171662.0, the announcement number CN100575488C, and the method in Example 2 of the instruction manual, the oil body expression vector p1390ONE was constructed; the nucleotide sequence of human EGF was artificially synthesized according to the codons preferred by plants (as shown in the sequence table SEQ ID NO.1);
[0038] Using the nucleotide sequence of artificially synthesized human EGF as a template, use primers:
[0039] P1: CAAGCTT AATTCAGACTCTGAATGTCC
[0040] P2: GGAATTCTTATTCTCAGTTCCCACCACTTC
[0041] For amplification, the PCR product EGF was digested by HindⅢ and EcoRI and ligated to pUC19 to obtain pUC-EGF. use KpnⅠ and SpeI Double digestion plasmid pUC- EGF and the oil body expression vector p1390ONE, the nucleotide sequence of artificially synthesized human EGF was connected to the oil body expression vector p1390ONE; the recombinant plas...
Embodiment 2
[0042] Example 2 Extraction of safflower oil body
[0043] Take 30g of safflower seeds, wash 3 times with sterilized pure water in a sterile environment, add 5 times the volume
[0044] Buffer I (0.1M Tris-KOH pH7.0, 10mM KCl, 1mM MgCl 2 , 1mM EDTA, O.6M sucrose) were crushed and homogenized, filtered through three layers of gauze, and centrifuged at 6000g 4°C for 20 minutes;
[0045] The solid material in the upper layer was resuspended with buffer I containing 0.6M sucrose, slowly added an equal volume of buffer I containing 0.1M sucrose, centrifuged at 15000g, 4°C for 20 minutes, and repeated once;
[0046] The solid matter in the upper layer was resuspended with buffer I containing 0.1M sucrose, centrifuged at 15000g, 4°C for 20 minutes, and repeated once.
[0047] The solid matter in the upper layer was fully resuspended with sucrose-free buffer I, centrifuged at 15000g, 4°C for 20 minutes, and repeated twice. The obtained upper flake is the oil body, which is set as...
Embodiment 3
[0048] Example 3 Determination of the activity of oil bodies containing EGF safflower
[0049] The NIH 3T3 cell line was fully cultured at 37°C, 5% CO 2 Cultured, the cells are in the logarithmic growth phase, and used for the determination of biological activity. Digest and collect the cells, make 5.0×10 with complete culture medium 4 -1.0×10 5 cells / mL cell suspension, seeded in 96-well cell culture plate, 100 μL per well, 37°C, 5% CO 2 Culture, change the maintenance medium (0.3-1% serum) after 24 hours, change the medium, 37°C, 5% CO 2 Incubate for 24 hours. Discard the maintenance solution on the prepared cell culture plate, add the test solution, 100 μL per well, 37°C, 5% CO 2 Incubate for 48 hours, 20 μL MTT solution per well, 37°C, 5% CO 2Incubate for 4-6 hours. After discarding the liquid in the plate, add 100 μL of DMSO to the well, mix well, put it into a microplate reader, measure the absorbance at 570 nm with 630 nm as the reference wavelength, and record...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



