Vegetable oil body gel containing EGF (Epidermal Growth Factor)
A vegetable oil body and gel technology, applied in the biological field, can solve problems such as inconvenient use
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1 The acquisition of safflower EGF transgenic seeds
[0037] According to the Chinese patent ZL 200610171662.0, the announcement number CN100575488C, and the method in Example 2 of the instruction manual, the oil body expression vector p1390ONE was constructed; the nucleotide sequence of human EGF was artificially synthesized according to the codons preferred by plants (as shown in the sequence table SEQ ID NO.1);
[0038] Using the nucleotide sequence of artificially synthesized human EGF as a template, use primers:
[0039] P1: CAAGCTT AATTCAGACTCTGAATGTCC
[0040] P2: GGAATTCTTATTCTCAGTTCCCACCACTTC
[0041] For amplification, the PCR product EGF was digested by HindⅢ and EcoRI and ligated to pUC19 to obtain pUC-EGF. use KpnⅠ and SpeI Double digestion plasmid pUC- EGF and the oil body expression vector p1390ONE, the nucleotide sequence of artificially synthesized human EGF was connected to the oil body expression vector p1390ONE; the recombinant plas...
Embodiment 2
[0042] Example 2 Extraction of safflower oil body
[0043] Take 30g of safflower seeds, wash 3 times with sterilized pure water in a sterile environment, add 5 times the volume
[0044] Buffer I (0.1M Tris-KOH pH7.0, 10mM KCl, 1mM MgCl 2 , 1mM EDTA, O.6M sucrose) were crushed and homogenized, filtered through three layers of gauze, and centrifuged at 6000g 4°C for 20 minutes;
[0045] The solid material in the upper layer was resuspended with buffer I containing 0.6M sucrose, slowly added an equal volume of buffer I containing 0.1M sucrose, centrifuged at 15000g, 4°C for 20 minutes, and repeated once;
[0046] The solid matter in the upper layer was resuspended with buffer I containing 0.1M sucrose, centrifuged at 15000g, 4°C for 20 minutes, and repeated once.
[0047] The solid matter in the upper layer was fully resuspended with sucrose-free buffer I, centrifuged at 15000g, 4°C for 20 minutes, and repeated twice. The obtained upper flake is the oil body, which is set as...
Embodiment 3
[0048] Example 3 Determination of the activity of oil bodies containing EGF safflower
[0049] The NIH 3T3 cell line was fully cultured at 37°C, 5% CO 2 Cultured, the cells are in the logarithmic growth phase, and used for the determination of biological activity. Digest and collect the cells, make 5.0×10 with complete culture medium 4 -1.0×10 5 cells / mL cell suspension, seeded in 96-well cell culture plate, 100 μL per well, 37°C, 5% CO 2 Culture, change the maintenance medium (0.3-1% serum) after 24 hours, change the medium, 37°C, 5% CO 2 Incubate for 24 hours. Discard the maintenance solution on the prepared cell culture plate, add the test solution, 100 μL per well, 37°C, 5% CO 2 Incubate for 48 hours, 20 μL MTT solution per well, 37°C, 5% CO 2Incubate for 4-6 hours. After discarding the liquid in the plate, add 100 μL of DMSO to the well, mix well, put it into a microplate reader, measure the absorbance at 570 nm with 630 nm as the reference wavelength, and record...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap