Recombinant protein subunit vaccine for resisting porcine circovirus serotype 2
A circovirus and protein technology, applied in the field of immunology, to achieve the effect of enhancing immune response, strong immunogenicity, and good protection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1 Fusion expression of porcine circovirus type 2 Cap protein and Salmonella typhimurium flagellin in insect Sf9 cells
[0027] 1.1 Construction of recombinant vector
[0028] 1.1.1 PCR amplification of ΔORF2, Flagellin-ORF2 and Flagellin-ΔORF2 genes:
[0029] The artificially synthesized ΔORF2 gene is a gene encoding Cap protein that deletes the nuclear localization signal, and its nucleotide sequence is shown in SEQ ID No.9; the artificially synthesized Flagellin-ORF2 gene nucleic acid sequence is shown in SEQ ID No.1; Flagellin - The nucleotide sequence of the ΔORF2 gene is shown in SEQ ID No.10.
[0030] The upstream and downstream primers of ΔORF2 gene are:
[0031] Upstream primer (P1): CCCTCGAGGAATGGCATCTTCAACACCCG
[0032] Downstream primer (P2): CCCAAGCTTGGAGGGTTAAGTGGGGGGTCTTTAA;
[0033] The upstream and downstream primers of Flagelllin-ORF2 and Flagelllin-ΔORF2 are:
[0034] Upstream primer (P3): CCCTCGAGGATGACGTATCCAAGGAGGCG
[0035] Downstream...
Embodiment 2
[0058] Example 2 Study on the Immunogenicity of Fusion Expression Product of Porcine Circovirus Type 2 Cap Protein and Salmonella Typhimurium Flagellin
[0059] 2.1 Indirect ELISA detection of serum IgG antibody level
[0060] The mice were divided into 10 groups, among which 5 groups were immunized with 2 μg of PBS, Bac-ΔORF2 recombinant protein, Bac-ORF2 recombinant protein, Bac-Flagellin-ΔORF2 recombinant protein, Bac-Flagellin-ORF2 recombinant protein; the other 5 groups were immunized with 10 μg of PBS, Bac-ΔORF2 recombinant protein, Bac-ORF2 recombinant protein, Bac-Flagellin-ΔORF2 recombinant protein, Bac-Flagellin-ORF2 recombinant protein. After immunization, the tail blood was collected every week to detect the serum antibody level.
[0061] The purified Bac-ΔORF2 fusion protein was used to coat the ELISA plate, and the mouse sera collected on the 7th, 14th, 21st, and 28th days after the primary immunization and the 7th, 14th, and 21st days after the challenge (PI) w...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



