Supercharge Your Innovation With Domain-Expert AI Agents!

Recombinant protein subunit vaccine for resisting porcine circovirus serotype 2

A circovirus and protein technology, applied in the field of immunology, to achieve the effect of enhancing immune response, strong immunogenicity, and good protection

Active Publication Date: 2014-04-23
BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have shown that the fusion of West Nile virus envelope protein and flagellin to make vaccine immunization can produce neutralizing antibodies and protective antibodies against virus attack, while immunization with subunit antigen alone cannot produce suitable protective antibody responses

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant protein subunit vaccine for resisting porcine circovirus serotype 2
  • Recombinant protein subunit vaccine for resisting porcine circovirus serotype 2
  • Recombinant protein subunit vaccine for resisting porcine circovirus serotype 2

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Fusion expression of porcine circovirus type 2 Cap protein and Salmonella typhimurium flagellin in insect Sf9 cells

[0027] 1.1 Construction of recombinant vector

[0028] 1.1.1 PCR amplification of ΔORF2, Flagellin-ORF2 and Flagellin-ΔORF2 genes:

[0029] The artificially synthesized ΔORF2 gene is a gene encoding Cap protein that deletes the nuclear localization signal, and its nucleotide sequence is shown in SEQ ID No.9; the artificially synthesized Flagellin-ORF2 gene nucleic acid sequence is shown in SEQ ID No.1; Flagellin - The nucleotide sequence of the ΔORF2 gene is shown in SEQ ID No.10.

[0030] The upstream and downstream primers of ΔORF2 gene are:

[0031] Upstream primer (P1): CCCTCGAGGAATGGCATCTTCAACACCCG

[0032] Downstream primer (P2): CCCAAGCTTGGAGGGTTAAGTGGGGGGTCTTTAA;

[0033] The upstream and downstream primers of Flagelllin-ORF2 and Flagelllin-ΔORF2 are:

[0034] Upstream primer (P3): CCCTCGAGGATGACGTATCCAAGGAGGCG

[0035] Downstream...

Embodiment 2

[0058] Example 2 Study on the Immunogenicity of Fusion Expression Product of Porcine Circovirus Type 2 Cap Protein and Salmonella Typhimurium Flagellin

[0059] 2.1 Indirect ELISA detection of serum IgG antibody level

[0060] The mice were divided into 10 groups, among which 5 groups were immunized with 2 μg of PBS, Bac-ΔORF2 recombinant protein, Bac-ORF2 recombinant protein, Bac-Flagellin-ΔORF2 recombinant protein, Bac-Flagellin-ORF2 recombinant protein; the other 5 groups were immunized with 10 μg of PBS, Bac-ΔORF2 recombinant protein, Bac-ORF2 recombinant protein, Bac-Flagellin-ΔORF2 recombinant protein, Bac-Flagellin-ORF2 recombinant protein. After immunization, the tail blood was collected every week to detect the serum antibody level.

[0061] The purified Bac-ΔORF2 fusion protein was used to coat the ELISA plate, and the mouse sera collected on the 7th, 14th, 21st, and 28th days after the primary immunization and the 7th, 14th, and 21st days after the challenge (PI) w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a recombinant protein subunit vaccine for resisting a porcine circovirus serotype 2. The recombinant protein subunit vaccine is a fused protein of a salmonella typhosa flagellin with relatively high immunogenicity and a porcine circovirus serotype 2 Cap protein. Manually coded Flagellin-ORF2 (Open Reading Frame) and Flagellin-delta ORF2 genes are fused and cloned in a pFastBac expression vector, and recombined and cloned together with ORF2 and deltaORF2 (pFastBac vector) for transfecting Sf9 cell, four fused proteins are expressed by using a baculovirus system and identified by using immunofluorescence assay (IFA) and Western-blot. A period of recombining baculovirus by the system is short, and the expressed flagellin+Cap fused protein is high in immune protection force.

Description

technical field [0001] The invention relates to the field of immunology, in particular to a subunit vaccine against porcine type 2 circovirus disease. Background technique [0002] Porcine circovirus was first identified in 1974 in the porcine kidney cell line PK15 and is considered non-pathogenic. In 1991, a disease called Postweaning multisystemic wasting syndrome (PMWS) was found in Canadian pig herds, and it was found that it was mainly caused by a pathogenic porcine circovirus, which was classified by the International Society of Taxonomy The non-pathogenic porcine circovirus is classified as PCV1 as PCV2. PCV2 belongs to the genus Circovirus of the Circoviridae family, and its genome is composed of a circular single-stranded DNA. It is the smallest animal virus found so far. PCV2 contains two main reading frames, ORF1 and ORF2, in which ORF1 is responsible for encoding the protein (Rep) associated with viral replication, while ORF2 encodes the structural protein Cap ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/866C12N5/10A61K39/12A61K39/39A61P31/20
Inventor 刘爵张春燕韦莉王菁朱珊珊全荣阎旭李子璇
Owner BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More