Specific trichomonas vaginalis nested PCR (Polymerase Chain Reaction) detection kit
A technology of trichomonas vaginalis and detection kit, which is applied to the determination/testing of microorganisms, methods based on microorganisms, DNA/RNA fragments, etc., to achieve the effect of improving sensitivity, high sensitivity, and simple and easy operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Trichomonas vaginalis specific detection and diagnosis sequence: Trichomonas vaginalis G3 adhesion protein AP51-3 partial gene sequence. See Sequence Listing 1.
Embodiment 2
[0038] According to Example 1 Trichomonas vaginalis G3 adhesion protein AP51-3 partial gene sequence design specific nested PCR detection primers are as follows:
[0039] f 1 :GCCCGTAACTTCAACATCC
[0040] R 1 : TCCTCAACACCGTTCTCGT
[0041] f 2 : AAGGCTCAGGTCTACTGTGGT
[0042] R 2 : ATTGTCTGGGCAACTTCCTCT;
[0043] The above two primers can amplify specific detection gene fragments in different systems (nested PCR), the target bands are bright, and there are no non-specific bands. Realize the purpose of detecting Trichomonas vaginalis.
Embodiment 3
[0045] Trichomonas vaginalis PCR detection kit, the composition structure is as follows:
[0046] (1) DNA lysis solution: a mixed solution containing different concentrations of NaCl, Tris-HCl, EDTA, SDS and proteinase K. The ratio of each concentration is: NaCl 100mM, Tris-HCl (pH 7.5) 20Mm, EDTA 25Mm, SDS 2% (w / v) and proteinase K 0.1μg / μl. The function of the lysate is to lyse the nucleated cells (leukocytes, epithelial cells, etc.) in the urine and digest the proteins in them to release the genomic DNA.
[0047] (2) PCR reaction solution: 4 kinds of dNTPs with a final concentration of 100-300 μM each, primer F with a final concentration of 10-100 pmol / μl 1 R 1 f 2 R 2 , 1.5-4.5mM Mg 2+ concentration. Add 2.0 U of Taq enzyme to each PCR reaction (20 μl), and the reaction solution does not contain Taq enzyme.
[0048] (3) Positive control: The positive control used in the kit of the present invention is Trichomonas vaginalis genomic DNA, and its function is to comp...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com