Specific trichomonas vaginalis nested PCR (Polymerase Chain Reaction) detection kit
A technology of trichomonas vaginalis and detection kit, which is applied to the determination/testing of microorganisms, methods based on microorganisms, DNA/RNA fragments, etc., to achieve the effect of improving sensitivity, high sensitivity, and simple and easy operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Trichomonas vaginalis specific detection and diagnosis sequence: Trichomonas vaginalis G3 adhesion protein AP51-3 partial gene sequence. See Sequence Listing 1.
Embodiment 2
[0038] According to Example 1 Trichomonas vaginalis G3 adhesion protein AP51-3 partial gene sequence design specific nested PCR detection primers are as follows:
[0039] f 1 :GCCCGTAACTTCAACATCC
[0040] R 1 : TCCTCAACACCGTTCTCGT
[0041] f 2 : AAGGCTCAGGTCTACTGTGGT
[0042] R 2 : ATTGTCTGGGCAACTTCCTCT;
[0043] The above two primers can amplify specific detection gene fragments in different systems (nested PCR), the target bands are bright, and there are no non-specific bands. Realize the purpose of detecting Trichomonas vaginalis.
Embodiment 3
[0045] Trichomonas vaginalis PCR detection kit, the composition structure is as follows:
[0046] (1) DNA lysis solution: a mixed solution containing different concentrations of NaCl, Tris-HCl, EDTA, SDS and proteinase K. The ratio of each concentration is: NaCl 100mM, Tris-HCl (pH 7.5) 20Mm, EDTA 25Mm, SDS 2% (w / v) and proteinase K 0.1μg / μl. The function of the lysate is to lyse the nucleated cells (leukocytes, epithelial cells, etc.) in the urine and digest the proteins in them to release the genomic DNA.
[0047] (2) PCR reaction solution: 4 kinds of dNTPs with a final concentration of 100-300 μM each, primer F with a final concentration of 10-100 pmol / μl 1 R 1 f 2 R 2 , 1.5-4.5mM Mg 2+ concentration. Add 2.0 U of Taq enzyme to each PCR reaction (20 μl), and the reaction solution does not contain Taq enzyme.
[0048] (3) Positive control: The positive control used in the kit of the present invention is Trichomonas vaginalis genomic DNA, and its function is to comp...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
