Yak meat tenderness candidate gene detection kit and detection method thereof
A technology for detecting kits and candidate genes, applied in biochemical equipment and methods, microbe determination/testing, DNA/RNA fragments, etc., can solve the problems of high sensitivity and low cost, and achieve high sensitivity and low cost , strong specific effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Embodiment 1: a kind of PCR-SSCP detection primer of tenderness candidate gene of yak meat, its main feature is to include:
[0044] The primer sequences are:
[0045] CAPN3-F: 5'CAGAGTCTCCAGGACACTCACACA3';
[0046] CAPN3-R: 5'CCTTAGAAGGCAGCTCTGAAATTGTG3'.
Embodiment 2
[0047] Embodiment 2: a kind of PCR-SSCP detection kit of tenderness candidate gene of yak meat, its main feature is to comprise PCR reaction liquid, the DNA standard sample of CAPN3*B and CAPN3*C; Deionized water, 10% persulfuric acid Ammonium, loading denaturing buffer, TEMED, 12% non-denaturing polyacrylamide gel Arc:Bis=37.5:1;
[0048] The loading denaturing buffer includes 98% deionized formamide, 0.025% bromophenol blue, 0.025% xylene cyanol, 10mmol / L EDTA pH8.0;
[0049] The PCR reaction solution: a total volume of 20 μL, of which 10×buffer buffer is 2.0 μL, Mg 2+ The concentration is 2.5mM, the final concentration of dNTPs is 100μM, the primers CAPN3-F: 5'CAGAGTCTCCAGGACACTCACACA3' and CAPN3-R: 5'CCTTAGAAGGCAGCTCTGAAATTGTG3' are each 0.1μM, Taq polymerase 0.5U, ddH 2 O make up the volume to 20 μL.
[0050] The nucleotide sequence of the DNA standard sample of CAPN3*B is:
[0051]
[0052] The nucleotide sequence of the DNA standard sample of CAPN3*C is:
[0053]...
Embodiment 3
[0054] Embodiment 3: the using method of described yak meat tenderness candidate gene PCR-SSCP detection kit, its steps are:
[0055] (1) 1μL / 50ng of yak genomic DNA to be tested was mixed with the PCR amplification solution in the kit. The reaction conditions were: pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30s, annealing at 62°C for 30s, extension at 72°C for 30s, a total of 35 cycles, and finally Extend at 72°C for 10 minutes to amplify;
[0056] (2) Use the PCR product amplified in step (1) and the DNA standard sample of CAPN3*B or CAPN3*C to mix with the components of the SSCP detection reagent in the kit for SSCP detection;
[0057] (3) The samples whose band pattern detected in step (2) was consistent with the standard transect pattern of CAPN3*B or CAPN3*C were individuals carrying the control allele for tenderness of yak meat.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap