Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Molecular markers m3b-1a and m3b-2a of the qtl locus qphs.sicau-3b.1 for ear germination resistance in wheat and their applications

A molecular marker, m3b-2a technology, applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., can solve economic losses of wheat, increased activity of hydrolytic enzymes, deterioration of wheat food processing quality, etc. question

Active Publication Date: 2016-08-17
SICHUAN AGRI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Ear germination before wheat seeds are harvested will lead to a rapid increase in the activity of related hydrolytic enzymes in wheat grains, degrade the storage substances in the grains, and reduce the testing weight, flour yield and flour falling number (Falling number), resulting in wheat The quality of various food processing deteriorates, which will seriously affect the storage of wheat and the quality of sowing in the next year
These will cause serious economic losses to the production and processing of wheat

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular markers m3b-1a and m3b-2a of the qtl locus qphs.sicau-3b.1 for ear germination resistance in wheat and their applications
  • Molecular markers m3b-1a and m3b-2a of the qtl locus qphs.sicau-3b.1 for ear germination resistance in wheat and their applications
  • Molecular markers m3b-1a and m3b-2a of the qtl locus qphs.sicau-3b.1 for ear germination resistance in wheat and their applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0099] Example 1 Mapping of main QTL for wheat CSCR6 resistance to panicle germination and acquisition of molecular markers

[0100] 1) Using CSCR6, an ear-resistant germination wheat material, as the female parent, and crossing the Australian ear-sensing germination variety Lang as the male parent, the hybrid F1 was obtained, and the recombinant inbred line F7 composed of 92 progeny was constructed according to the single-grain transmission method. group.

[0101] 2) RIL F7 panicle germination identification

[0102] Harvest wheat seeds at the wax maturity stage, hang them in a cool and ventilated place to dry naturally for 7 days, and then perform manual threshing. Spread filter paper wetted with 3-5ml distilled water in a covered plastic Petri dish for germination test. The test design is repeated three times, with 50 seeds in each repetition. Pick out the white and moldy seeds every other day, and count them respectively. The germination rate of the seeds is represented ...

Embodiment 2

[0121] Example 2 The application test of the molecular markers of the present invention in the selection of the main effect QTLQPhs.sicau-3B.1 for anti-ear germination

[0122] 1) Using CSCR6 as the female parent and Bellaroi as the male parent, a F7 recombinant inbred line (RILs) consisting of 108 materials was constructed by single seed transmission.

[0123] 2) Mark detection of the obtained F7 progeny, the specific method is: extract the genomic DNA of the F7 generation single plant at the seedling stage; use the genomic DNA as the substrate, and use the developed STS to mark the M3B-1a, M3B-2a The primer pair is used for primers to carry out PCR amplification respectively, and the primers are:

[0124] M3B-1a:

[0125] Forward primer: 5'-3'TGCAGCGTGGTTTGGG

[0126] Reverse primer: 5'-3'TGCAGAGTCAAAGAACTATGATAG

[0127] M3B-2a:

[0128] Forward primer: 5'-3'TTAGTCCACTGAGAACATGGCG

[0129] Reverse primer: 5’-3’ACGTGGGAGGATGTGCAAAG

[0130] PCR amplification system:

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses two pairs of primer pairs for screening new quantitative trait loci (QTL) related to resistance to wheat preharvest sprouting as well as a method and applications thereof in the field of wheat molecule breeding. Analysis shows that the developed molecular markers M3B-1a and M3B-2a can accurately track preharvest sprouting resistance main-effect QTL QPhs.sicau-3B.1 of spelt wheat CSCR6, and predict the wheat preharvest sprouting resistance. Thus, the preharvest sprouting resistance material can be more conveniently identified and screened under the laboratory condition. The effect on phenotype caused by an environmental factor and a human factor can be avoided by using a molecular-assisted breeding technique. By adopting the main-effect QTL QPhs.sicau-3B.1 and developed two pairs of STS markers M3B-1a and M3B-2a tightly interlocked with the QTL disclosed by the invention, a new candidate gene can be provided, the selection accuracy of the preharvest sprouting resistance breeding material is improved, and the target of wheat preharvest sprouting resistance breeding is achieved.

Description

technical field [0001] The invention relates to the field of wheat molecular breeding, in particular to a primer pair, a molecular marker, a molecular marker method and an application for identifying and screening a new main QTL locus QPhs.sicau-3B.1 for wheat resistance to panicle germination. Background technique [0002] Wheat is a food crop widely planted in the world, and it is also the crop planted second only to rice in my country. Pre-harvest Sprouting (PHS) refers to the fact that wheat seeds encounter continuous rainy weather in the early stage of harvest and grow on the ears. Condition of germination. Ear sprouting is a worldwide disaster. It has been reported that wheat grown in coastal areas of northern and western Europe, most of Chile, Argentina, Brazil, South Africa, Zimbabwe, the Saskanche and Manitoba regions of Canada, eastern New Zealand, and eastern New Zealand are more susceptible to ear germination, and the western Pacific Ocean of the United States. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 王际睿刘亚西刘宇娇毛双双江千涛蒲至恩陈国跃魏育明郑有良
Owner SICHUAN AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com