Identified mmu-miR-217-5p capable of detecting toxoplasma gondii infection
A Toxoplasma gondii, identifying technology, applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of affecting diagnosis, low specificity and sensitivity, laborious and other problems, and achieve high sensitivity and specific and reliable detection basis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1B
[0016] Example 1 BALB / c challenge experiment
[0017] Sixty BALB / c mice aged 6-8 weeks were randomly divided into 3 groups, 20 mice in each group, and the tachyzoites of RH strain and ME49 strain were injected intraperitoneally into the two groups respectively. 6 The third group was the healthy control group, and the infection of parasites was determined by Giemsa staining method and blood smear DNA method.
Embodiment 2
[0018] Example 2 plasma total RNA extraction
[0019] 72 hours after infection, the anticoagulant blood of all mice was obtained by taking blood from the eyeball. Centrifuge the anticoagulated blood at room temperature at 1200g / min for 10 minutes, take the supernatant and then centrifuge at 12000g / min at 4°C for 10 minutes, and take the supernatant as the processed plasma sample.
[0020] Extraction of plasma total RNA using mirVana TM miRNA Isolation Kit (Ambion, USA) kit, the synthesized cel-miR-39 was added to plasma as an external reference, and the specific steps were as follows:
[0021] 1. Add 600 μL 2×Denaturing Solution to every 600 μL plasma, mix well, and incubate on ice for 5 minutes.
[0022] 2. Add 1200 μL phenol chloroform, vortex for 1 minute, and centrifuge at 10000 g / min for 5 minutes.
[0023] 3. Take the supernatant and add 1.25 times the volume of ethanol, filter the mixture through a column, centrifuge at 10000g / min for 30 seconds, and discard the fil...
Embodiment 3
[0027] The establishment of embodiment 3 reverse transcription and Q-PCR system
[0028] 1. Reverse transcription
[0029] 50 ng of total RNA was reverse-transcribed using the miScript II Reverse Transcription kit (Qiagen, Germany). The reaction system is shown in Table 1. Mix the liquid, incubate at 37°C for 1 hour, then bathe at 95°C for 5 minutes, and store at -20°C. Keep it for a long time.
[0030] Table 1 Reverse transcription reaction system
[0031]
[0032] 2. Q-PCR
[0033] Q-PCR was performed for mmu-miR-217-5p.
[0034] Table 2 Basic information related to mmu-miR-217-5p
[0035]
[0036] Using the cDNA obtained by reverse transcription as a template, the miRNA primers containing the sequence TACTGCATCAGGAACTGACTGGA synthesized by Qiagen (Qiagen Biotechnology Co., Ltd., No. 88 Darwin Road, Zhangjiang High-tech Park, Pudong, Shanghai) were used for Q-PCR amplification, using miScript SYBR Green PCR Kit (Qiagen, Germany), the reaction system is shown in Ta...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
