Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Identified mmu-miR-217-5p capable of detecting toxoplasma gondii infection

A Toxoplasma gondii, identifying technology, applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of affecting diagnosis, low specificity and sensitivity, laborious and other problems, and achieve high sensitivity and specific and reliable detection basis

Inactive Publication Date: 2014-06-18
JILIN UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional etiological inspection methods such as microscopic examination and parasite isolation are time-consuming and laborious, and their specificity and sensitivity are not high, so they cannot meet the current needs of diagnosis and control of toxoplasmosis
Immunological diagnosis method, that is, to detect Toxoplasma gondii antibody, but patients with toxoplasmosis are often accompanied by low immune function, and the antibody level often decreases, making it difficult to make a correct diagnosis
The diagnostic methods of molecular biology are simple and fast, with good sensitivity and high specificity, including ordinary PCR, nested PCR, fluorescent quantitative PCR, in situ PCR, etc. The diagnostic gene targets used include B1, ITS-1, P30 genes, etc. , but because the copy number of these diagnostic genes in the Toxoplasma gondii genome is not high (1-30 copies), it affects the diagnosis of the disease

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Identified mmu-miR-217-5p capable of detecting toxoplasma gondii infection
  • Identified mmu-miR-217-5p capable of detecting toxoplasma gondii infection
  • Identified mmu-miR-217-5p capable of detecting toxoplasma gondii infection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1B

[0016] Example 1 BALB / c challenge experiment

[0017] Sixty BALB / c mice aged 6-8 weeks were randomly divided into 3 groups, 20 mice in each group, and the tachyzoites of RH strain and ME49 strain were injected intraperitoneally into the two groups respectively. 6 The third group was the healthy control group, and the infection of parasites was determined by Giemsa staining method and blood smear DNA method.

Embodiment 2

[0018] Example 2 plasma total RNA extraction

[0019] 72 hours after infection, the anticoagulant blood of all mice was obtained by taking blood from the eyeball. Centrifuge the anticoagulated blood at room temperature at 1200g / min for 10 minutes, take the supernatant and then centrifuge at 12000g / min at 4°C for 10 minutes, and take the supernatant as the processed plasma sample.

[0020] Extraction of plasma total RNA using mirVana TM miRNA Isolation Kit (Ambion, USA) kit, the synthesized cel-miR-39 was added to plasma as an external reference, and the specific steps were as follows:

[0021] 1. Add 600 μL 2×Denaturing Solution to every 600 μL plasma, mix well, and incubate on ice for 5 minutes.

[0022] 2. Add 1200 μL phenol chloroform, vortex for 1 minute, and centrifuge at 10000 g / min for 5 minutes.

[0023] 3. Take the supernatant and add 1.25 times the volume of ethanol, filter the mixture through a column, centrifuge at 10000g / min for 30 seconds, and discard the fil...

Embodiment 3

[0027] The establishment of embodiment 3 reverse transcription and Q-PCR system

[0028] 1. Reverse transcription

[0029] 50 ng of total RNA was reverse-transcribed using the miScript II Reverse Transcription kit (Qiagen, Germany). The reaction system is shown in Table 1. Mix the liquid, incubate at 37°C for 1 hour, then bathe at 95°C for 5 minutes, and store at -20°C. Keep it for a long time.

[0030] Table 1 Reverse transcription reaction system

[0031]

[0032] 2. Q-PCR

[0033] Q-PCR was performed for mmu-miR-217-5p.

[0034] Table 2 Basic information related to mmu-miR-217-5p

[0035]

[0036] Using the cDNA obtained by reverse transcription as a template, the miRNA primers containing the sequence TACTGCATCAGGAACTGACTGGA synthesized by Qiagen (Qiagen Biotechnology Co., Ltd., No. 88 Darwin Road, Zhangjiang High-tech Park, Pudong, Shanghai) were used for Q-PCR amplification, using miScript SYBR Green PCR Kit (Qiagen, Germany), the reaction system is shown in Ta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses identified mmu-miR-217-5p capable of detecting toxoplasma gondii infection. In a toxoplasma gondii infected mouse model, cDNA (complementary deoxyribonucleic acid) is obtained by extracting general RNA (ribonucleic acid) of plasma and inversely transcribing; high-expression mmu-miR-217-5p is screened by adopting a Q-PCR (quantitative polymerase chain reaction) technology, is remarkably related to toxoplasma gondii infection, and can be used as identified miRNA for toxoplasmosis diagnosis. The mmu-miR-217-5p is used as a marker to establish a Q-PCR detection method of toxoplasma gondii infection, has relatively high sensitivity and specificity, provides a reliable detection basis and quick detection method to clinical diagnosis for toxoplasmosis, and has an important clinical application value.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a marker mmu-miR-217-5p capable of detecting infection with Toxoplasma gondii. Background technique [0002] Toxoplasma gondii is an obligate intracellular parasite. The first human case was reported in 1908. It was discovered at the same time as animal toxoplasmosis. About 500 to 1 billion people in the world are infected with toxoplasmosis. Humans have been fighting against this disease for more than a century, but the disease is still around the world. raging. In my country, about 80,000 to 90,000 newborns are born every year due to damage caused by Toxoplasma gondii. The abnormal productivity of women infected with Toxoplasma gondii is three times that of normal pregnant women, resulting in teratogenic and stillbirth. WHO and US CDC have regarded toxoplasmosis as an indicative disease of AIDS. [0003] At present, it is believed that the Toxoplasma gondii isolated ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/113
CPCC12Q1/6883C12Q2600/158C12Q2600/178
Inventor 陈启军贾博寅姜宁
Owner JILIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com