A method for increasing the expression of exogenous protein in Pichia pastoris by thiol peroxidase
A technology of thiol peroxide and protein expression, which is applied in the direction of using vectors to introduce foreign genetic material, recombinant DNA technology, etc., can solve the problems of insufficient expression of target proteins and low expression efficiency, and achieve the goal of overcoming the accumulation of free radicals and reducing the response Mechanism influences and promotes the effect of exogenous protein secretion
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0010] Example 1: Overexpression of thiol peroxidase gene in methanol-inducible Pichia pastoris of exogenous recombinant protein.
[0011] Taking the Pichia pastoris GAP constitutive promoter expression vector to overexpress the Pichia thiol peroxidase gene as an example: design primers, clone the thiol peroxidase gene Tpx fragment from Pichia pastoris, and Komagataella pastoris GS115 published by NCBI The thiol peroxidase gene sequence (PAS_chr2-2_0382) was compared, and the homology analysis showed that the homology of the cloned gene fragment with the gene bank Komagataella pastoris GS115 thiol peroxidase gene was 100%.
[0012] The primer sequences are:
[0013] Tpx-F(EcoRI):5'CAGGAATTCATGTCTTCATTTTATGATCTGGCCCCATTA3'
[0014] Tpx-R(XbaI): 5'GCTCTAGATTACAACTGGTTTGCAGGTGGAAAATGTT3'
[0015] The cloned Tpx gene fragment and pGAPZB, a commonly used expression vector of Pichia pastoris, were digested with EcoRI and XbaI and ligated with T4 DNA ligase overnight at 16°C. The l...
Embodiment 2
[0017] Example 2: Fermentation of exogenous protein expression-enhanced strains overexpressing Tpx gene.
[0018] Medium: the seed and slant medium are yeast basic fermentation medium is BMGY medium (1L): peptone 20g, yeast extract 10g, glycerol 10%, YNB13.4g, 100mM phosphate buffer (pH6.0); induction The medium is BMMY medium (1L): 20g peptone, 10g yeast extract, 20g glucose; 20g agar added to solid medium; 13.4g YNB, 100mM phosphate buffer (pH6.0); 1% methanol, supplemented with methanol induction Add time interval is 24h.
[0019] Culture method: select Pichia pastoris positive transformants expressing β-glucuronidase and xylanase overexpressing thiol peroxidase gene, and inoculate them into YPD seed medium. The seeds cultivated at 30°C and 200rpm until the OD600 is between 1.6-1.7 are transferred to the basic fermentation medium with a 2% inoculation amount, and at 30°C and 200rpm; induction conditions: cultivated in BMGY until the OD value is 1.2- At 1.5, the yeast cell...
Embodiment 3
[0022] Example 3: The thiol peroxidase gene regulates the expression level of exogenous recombinant protein at the transcriptional level.
[0023] Check the thiol peroxidase gene sequence of several functionally related or similar sequences derived from Pichia pastoris or Saccharomyces cerevisiae and other species through the NCBI database, design primers, and design with OE-PCR or restriction site design. Constitutive and inducible promoter expression plasmids of different strengths from Pichia pastoris or Saccharomyces cerevisiae are connected, and methanol-inducible Pichia pastoris transformed into exogenous recombinant protein is co-expressed or overexpressed, and the promoter strength and induction method Regulate the level of thiol peroxidase gene transcription, and then affect the secretion and expression of recombinant protein in methanol-inducible Pichia pastoris engineering bacteria. The enzyme activity of exogenous protein expressed in strains with low copy of thiol...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap