A method for increasing the expression of exogenous protein in Pichia pastoris by thiol peroxidase

A technology of thiol peroxide and protein expression, which is applied in the direction of using vectors to introduce foreign genetic material, recombinant DNA technology, etc., can solve the problems of insufficient expression of target proteins and low expression efficiency, and achieve the goal of overcoming the accumulation of free radicals and reducing the response Mechanism influences and promotes the effect of exogenous protein secretion

Active Publication Date: 2016-03-02
BEIJING INSTITUTE OF TECHNOLOGYGY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most of the enzyme preparations and protein drugs widely used in food, medicine, light industry, chemical industry, environment and energy industries are obtained through the expression system of Pichia pastoris, but there are still insufficient expressions of target proteins from different sources. inefficiency defect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for increasing the expression of exogenous protein in Pichia pastoris by thiol peroxidase
  • A method for increasing the expression of exogenous protein in Pichia pastoris by thiol peroxidase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0010] Example 1: Overexpression of thiol peroxidase gene in methanol-inducible Pichia pastoris of exogenous recombinant protein.

[0011] Taking the Pichia pastoris GAP constitutive promoter expression vector to overexpress the Pichia thiol peroxidase gene as an example: design primers, clone the thiol peroxidase gene Tpx fragment from Pichia pastoris, and Komagataella pastoris GS115 published by NCBI The thiol peroxidase gene sequence (PAS_chr2-2_0382) was compared, and the homology analysis showed that the homology of the cloned gene fragment with the gene bank Komagataella pastoris GS115 thiol peroxidase gene was 100%.

[0012] The primer sequences are:

[0013] Tpx-F(EcoRI):5'CAGGAATTCATGTCTTCATTTTATGATCTGGCCCCATTA3'

[0014] Tpx-R(XbaI): 5'GCTCTAGATTACAACTGGTTTGCAGGTGGAAAATGTT3'

[0015] The cloned Tpx gene fragment and pGAPZB, a commonly used expression vector of Pichia pastoris, were digested with EcoRI and XbaI and ligated with T4 DNA ligase overnight at 16°C. The l...

Embodiment 2

[0017] Example 2: Fermentation of exogenous protein expression-enhanced strains overexpressing Tpx gene.

[0018] Medium: the seed and slant medium are yeast basic fermentation medium is BMGY medium (1L): peptone 20g, yeast extract 10g, glycerol 10%, YNB13.4g, 100mM phosphate buffer (pH6.0); induction The medium is BMMY medium (1L): 20g peptone, 10g yeast extract, 20g glucose; 20g agar added to solid medium; 13.4g YNB, 100mM phosphate buffer (pH6.0); 1% methanol, supplemented with methanol induction Add time interval is 24h.

[0019] Culture method: select Pichia pastoris positive transformants expressing β-glucuronidase and xylanase overexpressing thiol peroxidase gene, and inoculate them into YPD seed medium. The seeds cultivated at 30°C and 200rpm until the OD600 is between 1.6-1.7 are transferred to the basic fermentation medium with a 2% inoculation amount, and at 30°C and 200rpm; induction conditions: cultivated in BMGY until the OD value is 1.2- At 1.5, the yeast cell...

Embodiment 3

[0022] Example 3: The thiol peroxidase gene regulates the expression level of exogenous recombinant protein at the transcriptional level.

[0023] Check the thiol peroxidase gene sequence of several functionally related or similar sequences derived from Pichia pastoris or Saccharomyces cerevisiae and other species through the NCBI database, design primers, and design with OE-PCR or restriction site design. Constitutive and inducible promoter expression plasmids of different strengths from Pichia pastoris or Saccharomyces cerevisiae are connected, and methanol-inducible Pichia pastoris transformed into exogenous recombinant protein is co-expressed or overexpressed, and the promoter strength and induction method Regulate the level of thiol peroxidase gene transcription, and then affect the secretion and expression of recombinant protein in methanol-inducible Pichia pastoris engineering bacteria. The enzyme activity of exogenous protein expressed in strains with low copy of thiol...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for improving the expression quantity of a pichia pastoris foreign recombinant protein by using mercaptan peroxidase as a cofactor aiming at improving the preparation capability of the pichia pastoris foreign recombinant protein, belonging to the field of biochemical engineering. The method comprises the steps of connecting a mercaptan peroxidase gene with an inducible promoter or a constitutive promoter from pichia pastoris or saccharomyces cerevisiae to construct a gene expression vector, and transferring the gene expression vector to a methanol induced pichia pastoris strain for expressing the foreign recombinant protein to perform co-expression or over-expression, wherein the mercaptan peroxidase gene serving as a global control gene of oxidation reduction stress response improves the expression quantity of the foreign recombinant protein in the methanol induced pichia pastoris under the control effects of the promoter of different strengths and the transcriptional level of a gene copy number. The invention provides a new method for improving the capability of producing recombinant protein by cells and the bio-reaction efficiency, which has an important value for strengthening a biotechnology process.

Description

technical field [0001] The invention relates to a method for increasing the expression of exogenous protein of Pichia pastoris by using thiol peroxidase as an auxiliary factor, belonging to the field of biochemical industry. Background technique [0002] The Pichia pastoris eukaryotic expression system (Pichia pastoris) is suitable for large-scale fermentation because of its clear genetic background, simple technical operation, and low production cost. It is one of the most widely used expression systems at present. Most of the enzyme preparations and protein drugs widely used in food, medicine, light industry, chemical industry, environment and energy industries are obtained through the expression system of Pichia pastoris, but there are still insufficient expressions of target proteins from different sources. The defect of inefficiency. Reducing the cost of the fermentation process and improving the high expression efficiency of recombinant proteins has always been the mo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/67C12N15/81
Inventor李春皇甫洁普鸿丽
OwnerBEIJING INSTITUTE OF TECHNOLOGYGY