A strain of Cladomyces strain and method for producing β-glucosidase thereof
A technology of glucosidase and Cladomycetes, which is applied in the field of food biology, can solve the problems of no Cladomycetes, etc., and achieve the effects of convenient cultivation, stable enzyme properties, and simple fermentation process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0018] Cladomyces strains ( Aphanocladium sp.) SK34.001 is fermented under the following conditions:
[0019] Slope culture: PDA medium is used, and the components are expressed in g / L: potato 200, glucose 20, agar 20, natural pH, sterilized at 115°C for 30 minutes. The culture conditions are: culture temperature 30°C, culture time 5 days;
[0020] Seed culture: Beef extract peptone medium is used, and the components are calculated in g / L: beef extract 2.5, tryptone 5.0, sodium chloride 2.5, natural pH, sterilized at 121°C for 20 minutes. The culture conditions are: 250mL Erlenmeyer flask liquid 30mL, shaking flask rotation speed 200rpm, culture temperature 30℃, culture time 24h;
[0021] Fermentation culture: fermentation medium components in g / L: bran 35, ammonium sulfate 4.0, potassium dihydrogen phosphate 2.0, magnesium sulfate 0.3, calcium chloride 0.3, natural pH, sterilized at 121°C for 20 minutes. The culture conditions were as follows: the seed culture liquid was ...
Embodiment 2
[0023] Preparation of β-glucosidase enzyme powder:
[0024] Centrifuge the fermented liquid prepared in Example 1 at a rotating speed of 8000rpm for 30min to remove the bacteria to obtain the fermentation supernatant, remove salt and impurity proteins by ultrafiltration, then precipitate and dialyze through ammonium sulfate, and finally freeze-dry the dialysate That is, the β-glucosidase enzyme powder is obtained.
[0025] SEQ ID NO: 1
[0026] 596
[0027] DNA
[0028] Cladomycetes ( Aphanocladium sp.) SK34.001
[0029] 1
[0030] tccgtaggtgaacctgcggagggatcattacagagtttacaactcccaaaccctcatgtg60
[0031] aacataccacgatgttgcttcggcggactcgccccggcgtccggacggcctagcgccgcc120
[0032] cgcggcccggatccaggcggccgccggagaccaccaaaactattttgtatcagcagtttt180
[0033] ttctgaatccgccgcaaggcaaaacaaatgaatcaaaactttcaacaacggatctcttgg240
[0034] ttctggcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcag300
[0035] tgaatcatcgaatctttgaacgcacattgcgcccgccagcattctggcgggcatgcctgt360
[0036] ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com