Supercharge Your Innovation With Domain-Expert AI Agents!

A strain of Cladomyces strain and method for producing β-glucosidase thereof

A technology of glucosidase and Cladomycetes, which is applied in the field of food biology, can solve the problems of no Cladomycetes, etc., and achieve the effects of convenient cultivation, stable enzyme properties, and simple fermentation process

Inactive Publication Date: 2016-03-23
JIANGNAN UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there has been no Filamentosa ( Aphanocladium ) as a related research report of β-glucosidase producing bacteria

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Cladomyces strains ( Aphanocladium sp.) SK34.001 is fermented under the following conditions:

[0019] Slope culture: PDA medium is used, and the components are expressed in g / L: potato 200, glucose 20, agar 20, natural pH, sterilized at 115°C for 30 minutes. The culture conditions are: culture temperature 30°C, culture time 5 days;

[0020] Seed culture: Beef extract peptone medium is used, and the components are calculated in g / L: beef extract 2.5, tryptone 5.0, sodium chloride 2.5, natural pH, sterilized at 121°C for 20 minutes. The culture conditions are: 250mL Erlenmeyer flask liquid 30mL, shaking flask rotation speed 200rpm, culture temperature 30℃, culture time 24h;

[0021] Fermentation culture: fermentation medium components in g / L: bran 35, ammonium sulfate 4.0, potassium dihydrogen phosphate 2.0, magnesium sulfate 0.3, calcium chloride 0.3, natural pH, sterilized at 121°C for 20 minutes. The culture conditions were as follows: the seed culture liquid was ...

Embodiment 2

[0023] Preparation of β-glucosidase enzyme powder:

[0024] Centrifuge the fermented liquid prepared in Example 1 at a rotating speed of 8000rpm for 30min to remove the bacteria to obtain the fermentation supernatant, remove salt and impurity proteins by ultrafiltration, then precipitate and dialyze through ammonium sulfate, and finally freeze-dry the dialysate That is, the β-glucosidase enzyme powder is obtained.

[0025] SEQ ID NO: 1

[0026] 596

[0027] DNA

[0028] Cladomycetes ( Aphanocladium sp.) SK34.001

[0029] 1

[0030] tccgtaggtgaacctgcggagggatcattacagagtttacaactcccaaaccctcatgtg60

[0031] aacataccacgatgttgcttcggcggactcgccccggcgtccggacggcctagcgccgcc120

[0032] cgcggcccggatccaggcggccgccggagaccaccaaaactattttgtatcagcagtttt180

[0033] ttctgaatccgccgcaaggcaaaacaaatgaatcaaaactttcaacaacggatctcttgg240

[0034] ttctggcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcag300

[0035] tgaatcatcgaatctttgaacgcacattgcgcccgccagcattctggcgggcatgcctgt360

[0036] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an aphanocladium strain and a method for producing beta-glucosidase by the same, belonging to the field of food biotechnology. The invention provides a novel aphanocladium strain capable of producing beta-glucosidase. The aphanocladium strain is named as aphanocladium SK34.001 with a collection number of CCTCCNO: M2014090. According to the method disclosed by the invention, three-stage culture of slant culture, seed culture and fermentation culture is carried out on the aphanocladium strain for producing beta-glucosidase; and beta-glucosidase powder is obtained by separating and purifying from fermentation broth. The method for producing beta-glucosidase by aphanocladium SK34.001 is simple in fermentation process, easy to extract an enzyme, high in enzymatic property and stable in enzymatic property; waste resources such as bran can be directly used as a culture medium carbon source for the strain, thus saving energy consumption and reducing production cost; and the strain is wide in market application prospect.

Description

technical field [0001] The invention relates to a strain of Cladomycetes and a method for producing β-glucosidase, belonging to the field of food biotechnology. Background technique [0002] β-glucosidase (EC3.2.1.21), also known as β-D-glucosidase, can hydrolyze the non-reducing β-D-glucosidic bond bound to the end of the substrate, while releasing glucose and the corresponding Ligand. β-glucosidase exists in many plants, insects, yeasts, molds and bacteria in nature. It participates in the sugar metabolism of organisms and plays an important role in maintaining the normal physiological functions of organisms. [0003] β-glucosidase is widely distributed in nature and exists in almost all organisms, but its sources are different and its properties are different. The specificity of the enzyme to the non-sugar part of the glycoside is not strong, and it can hydrolyze many β-type glycosidic bonds. [0004] β-glucosidase is not only mainly used to degrade cellulose, but also...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/14C12N9/42C12R1/645
Inventor 江波张涛周林芳沐万孟缪铭
Owner JIANGNAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More