Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for distinguishing gynogenetic ctenopharyngodon idellus from common ctenopharyngodon idellus

A technology for gynogenesis and grass carp is applied in the field of molecular markers for identifying gynogenesis grass carp and common grass carp, which can solve the problems of easy confusion, limited detection sites, indistinguishable morphology and physiology, etc. Clear, consistent results

Inactive Publication Date: 2014-08-20
PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI +1
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, gynogenetic grass carp is indistinguishable from common grass carp in terms of morphology and physiology, and is easily confused in the actual breeding and conservation process. A molecular biological method that can distinguish gynogenetic grass carp from common grass carp was established by using microsatellite molecular markers Undoubtedly an effective way to solve this problem
[0003] At present, in the aspect of identifying gynogenetic grass carp, some scholars have used isozyme and RAPD marker technology to study the genetic diversity, homozygosity and loss of polymorphic sites of gynogenetic grass carp. However, isozymes are For gene expression products, the detection sites are limited, and it is not easy to distinguish varieties with close relationship or complex genetic basis; the stability and repeatability of RAPD markers are poor, and it is difficult to meet actual needs
In comparison, microsatellite (SSR) marker technology has been widely used in animals and plants due to its co-dominant inheritance, a large number of detection sites, high polymorphism, stable inheritance, and not affected by environmental conditions. There are no reports on species identification and other studies, and the use of microsatellite molecular markers to identify gynogenetic populations and common populations in the Yangtze River system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for distinguishing gynogenetic ctenopharyngodon idellus from common ctenopharyngodon idellus
  • Method for distinguishing gynogenetic ctenopharyngodon idellus from common ctenopharyngodon idellus
  • Method for distinguishing gynogenetic ctenopharyngodon idellus from common ctenopharyngodon idellus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] (1) Genomic DNA extraction

[0027] From May to July 2010, a group of 102 grass carp in the Yangtze River system were collected from three original breeding grounds of the four major domestic carps in Hubei and Hunan provinces to form the Yangtze River population. The sampling locations and numbers are shown in Table 1. Five Xingguo red carp males and 30 grass carp females from the Yangtze River system were used as parents, and the method of cold shock to inhibit the discharge of the second polar body was used to establish a heterospermous gynogenetic population of grass carp (approximately 100,000 fish in the level swimmer) . The gynogenetic grass carp progeny F1 population was used as the detection group (group G), and the wild grass carp population from the Yangtze River system was used as the control group (group W). 48 samples were randomly selected from each of the two groups, and the caudal fins were preserved in 95% Reserve in ethanol.

[0028] Table 1 Samplin...

Embodiment 2

[0052] (1) Genomic DNA extraction

[0053] Similar to (1) in Example 1, the difference is that the method of inhibiting the first cleavage by heat shock is used to establish the gynogenetic population of grass carp.

[0054] (2) PCR amplification

[0055] Using the genomic DNA solution prepared in step (1) as a template, 5 pairs of microsatellite primer pairs are used for PCR amplification respectively to obtain PCR amplification products. The SSR-PCR reaction system and procedure are as follows: 20 μL reaction system contains 10 μL of 10×buffer (reaction buffer), 0.5 μL of upstream and downstream primers, 40 ng of genomic DNA, and sterilized double-distilled water to make up the volume to 20 μL. The PCR amplification program was: 94°C pre-denaturation for 5 minutes, 94°C for 30s, 50-60°C for 30s, 72°C for 30s, 30 cycles, and 72°C for 7 minutes. The sequences of 5 pairs of microsatellite primers are as follows:

[0056] AAGGAACAGCATAAACCGAAAT GGAACCAAGCATCTGAAACTG

[0057]...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for distinguishing gynogenetic ctenopharyngodon idellus from common ctenopharyngodon idellus, and particularly provides a molecular marking method having the advantages of high polymorphism, genetic stability, high detection success ratio, wide utilization and the like; the molecular marking method is capable of quickly and accurately distinguishing gynogenetic ctenopharyngodon idellus from common ctenopharyngodon idellus. According to the difference in genetic homozygosity, five SSR (Simple Sequent Repeats) which are stable in amplification, clear in bands, polymorphic and great in genetic homozygosity difference in a gynogenetic population and a wild population are screened out from 14 SSR markers. As the genetic homozygosity in the gynogenetic population is greatly improved, the number of alleles amplified in the population by virtue of the SSRs is also reduced. Statistical analysis shows that the actual number of alleles amplified in the common ctenopharyngodon idellus by virtue of the five SSRs is 8-10 while the number of alleles amplified in the gynogenetic ctenopharyngodon idellus is 5-7, so that the gynogenetic ctenopharyngodon idellus and the common ctenopharyngodon idellus can be distinguished from each other by comparing the number of alleles, and the theoretical value of the accuracy rate can be 99.92%.

Description

【Technical field】 [0001] The invention belongs to the technical field of molecular markers and relates to a molecular marker method for identifying gynogenetic grass carp and common grass carp. 【Background technique】 [0002] Grass carp (Ctenopharyngodon idellus) belongs to Cyprinidae, Cyprinidae, and the genus Grass Carp, also known as grass carp, and is one of the important freshwater economically farmed fish in my country. Grass carp is widely distributed in my country, and its annual output accounts for about 20% of the total freshwater fish output in my country. In recent years, grass carp germplasm resources have been seriously degraded and diseases are frequent, which has brought huge losses to the grass carp aquaculture industry. However, due to the long period required for the reproduction of grass carp (generally 4-5 years for sexual maturity), the traditional methods for germplasm improvement and breeding of excellent varieties of grass carp are progressing slowl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6888C12Q2600/156
Inventor 全迎春韩林强白俊杰姜鹏于凌云樊佳佳马冬梅李胜杰胡重江
Owner PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI