Detection method of Chinese simmental cattle carcass and meat quality trait genetic markers
A Simmental cattle, genetic marker technology, applied in the field of genetic engineering detection of domestic carnivorous animals, to achieve high accuracy and low cost effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Obtaining bovine GPAM gene fragments and establishing a method for detecting polymorphisms in functional regions.
[0031] 1.1 Test materials: 245 34-month-old Chinese Ximenta bulls came from Baolongshan beef cattle fattening farm in Tongliao City, Inner Mongolia. Jugular vein blood collection, all blood samples were 10 mL / head, anticoagulated with ACD anticoagulant, and frozen at -20°C. Genomic DNA was extracted from blood samples using a genomic DNA extraction kit.
[0032] 1.2 Primer design and PCR amplification: Chinese Simmental cattle were selected as the test material, and the following 2 pairs of primers were designed according to the bovine GPAM gene sequence:
[0033] P1 forward primer F: 5' GAAGGAAGTAGCGTGAGGTGTG 3',
[0034] P1 reverse primer R: 5' TGCTGGGTTAATACAGGCTTGG 3';
[0035] P2 forward primer F: 5' GCAACAGAGGCACATCTGCATCGT,
[0036] P2 reverse primer R: 5' GCCAGATGCCAAGTCTCAAGTTCCT.
[0037] PCR amplification was performed in the Chinese Simmen...
Embodiment 2
[0043] Polymorphism distribution detection of genetic markers obtained from screening in Chinese Simmental cattle population.
[0044] Detection of polymorphism distribution frequency of PCR-Avr-Ⅱ-RFLP and PCR-Aci-Ⅰ-RFLP in exon 20 of GPAM gene in Chinese Simmental cattle population. The test results show that SNP1 (E20-2823 T>C) is a synonymous mutation, and the codons CTA and TTA before and after the mutation both code for leucine. Among the three genotypes of this SNP, the proportion of heterozygous TC individuals is relatively high , the frequency distributions of alleles T and C in the population were not significantly different. SNP2 (E20-3386 A>G) is a missense mutation. The codon CGC encoding arginine is mutated into the codon CAC encoding histidine. The A>G mutation at this site leads to amino acid changes, which may affect GPAM The structure and function of proteins have a certain influence. Among the three genotypes of this SNP, the wild-type AA genotype individua...
Embodiment 3
[0048] Association analysis and application of GPAM gene functional region genetic markers obtained from screening with carcass and meat quality traits of Chinese Simmental cattle.
[0049] Determination of traits: The carcass traits and meat quality traits studied include carcass weight, net meat percentage, hind leg circumference, hind leg width, hind leg length, thigh meat thickness, loin meat thickness, carcass length, carcass depth, carcass chest depth, backfat And carcass fat coverage, live eye muscle area. The determination of all characters is carried out according to the national standard GB / T1723821998.
[0050] In order to determine the correlation between the T 2823 C and A 3386 G mutation sites in the exon region of the GPAM gene and the carcass and meat quality traits of Chinese Simmental cattle, the Avr-Ⅱ-RFLP and Aci-Ⅰ- Ⅱ-RFLP method was used to detect polymorphism, and the ANOVA method of SPSS 13.0 was used to analyze the effects of different genotypes of SNP...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
