Detection method of Chinese simmental cattle carcass and meat quality trait genetic markers

A Simmental cattle, genetic marker technology, applied in the field of genetic engineering detection of domestic carnivorous animals, to achieve high accuracy and low cost effect

Active Publication Date: 2014-09-24
JILIN UNIV
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no report on the correlation between GPAM gene and catt

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method of Chinese simmental cattle carcass and meat quality trait genetic markers
  • Detection method of Chinese simmental cattle carcass and meat quality trait genetic markers
  • Detection method of Chinese simmental cattle carcass and meat quality trait genetic markers

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Obtaining bovine GPAM gene fragments and establishing a method for detecting polymorphisms in functional regions.

[0031] 1.1 Test materials: 245 34-month-old Chinese Ximenta bulls came from Baolongshan beef cattle fattening farm in Tongliao City, Inner Mongolia. Jugular vein blood collection, all blood samples were 10 mL / head, anticoagulated with ACD anticoagulant, and frozen at -20°C. Genomic DNA was extracted from blood samples using a genomic DNA extraction kit.

[0032] 1.2 Primer design and PCR amplification: Chinese Simmental cattle were selected as the test material, and the following 2 pairs of primers were designed according to the bovine GPAM gene sequence:

[0033] P1 forward primer F: 5' GAAGGAAGTAGCGTGAGGTGTG 3',

[0034] P1 reverse primer R: 5' TGCTGGGTTAATACAGGCTTGG 3';

[0035] P2 forward primer F: 5' GCAACAGAGGCACATCTGCATCGT,

[0036] P2 reverse primer R: 5' GCCAGATGCCAAGTCTCAAGTTCCT.

[0037] PCR amplification was performed in the Chinese Simmen...

Embodiment 2

[0043] Polymorphism distribution detection of genetic markers obtained from screening in Chinese Simmental cattle population.

[0044] Detection of polymorphism distribution frequency of PCR-Avr-Ⅱ-RFLP and PCR-Aci-Ⅰ-RFLP in exon 20 of GPAM gene in Chinese Simmental cattle population. The test results show that SNP1 (E20-2823 T>C) is a synonymous mutation, and the codons CTA and TTA before and after the mutation both code for leucine. Among the three genotypes of this SNP, the proportion of heterozygous TC individuals is relatively high , the frequency distributions of alleles T and C in the population were not significantly different. SNP2 (E20-3386 A>G) is a missense mutation. The codon CGC encoding arginine is mutated into the codon CAC encoding histidine. The A>G mutation at this site leads to amino acid changes, which may affect GPAM The structure and function of proteins have a certain influence. Among the three genotypes of this SNP, the wild-type AA genotype individua...

Embodiment 3

[0048] Association analysis and application of GPAM gene functional region genetic markers obtained from screening with carcass and meat quality traits of Chinese Simmental cattle.

[0049] Determination of traits: The carcass traits and meat quality traits studied include carcass weight, net meat percentage, hind leg circumference, hind leg width, hind leg length, thigh meat thickness, loin meat thickness, carcass length, carcass depth, carcass chest depth, backfat And carcass fat coverage, live eye muscle area. The determination of all characters is carried out according to the national standard GB / T1723821998.

[0050] In order to determine the correlation between the T 2823 C and A 3386 G mutation sites in the exon region of the GPAM gene and the carcass and meat quality traits of Chinese Simmental cattle, the Avr-Ⅱ-RFLP and Aci-Ⅰ- Ⅱ-RFLP method was used to detect polymorphism, and the ANOVA method of SPSS 13.0 was used to analyze the effects of different genotypes of SNP...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a detection method of Chinese simmental cattle carcass and meat quality trait genetic marker, and the method uses DNA pool sequencing and PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) technology for screening and detection of GPAM (glycerol-3-phosphate acyltransferase, mitochondrial) gene function mutation of Chinese simmental cattle. Through the correlation analysis, Chinese simmental cattle carcass and meat quality trait-related SNPs as a molecular genetic marker is found, and is used in the early selection and molecular pyramiding breeding of beef cattle, and breeding and improving of meat use performance of the Chinese simmental cattle can be further accelerated.

Description

technical field [0001] The invention discloses a method for detecting genetic markers of Chinese Simmental cattle carcass and meat quality traits, and belongs to the technical field of genetic engineering detection of domestic carnivorous animals. Background technique [0002] Chinese Simmental is a large-scale breed of milk and meat service that was independently bred in my country after it was introduced in the 1950s. Because of its strong physique, strong adaptability, and excellent milk, meat and service performance, it has become the most domestically raised and widely distributed breed. The most extensive variety is the leading variety in my country's beef cattle industry. With the changes in domestic and foreign markets and the increase in consumer demand for beef, further breeding and improvement of the performance of Chinese Simmental beef has become the main goal of this breed. In order to improve meat performance, conventional breeding techniques and molecular bre...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/683C12Q1/6888C12Q2600/124C12Q2600/156C12Q2531/113
Inventor 杨润军赵志辉于海滨孙博兴芦春艳张永宏沈冰蕾
Owner JILIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap