Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Diguanylate cyclase gene, vector, engineering bacteria and application

A technology of double guanylate cyclase and guanylate cyclase, applied in genetic engineering, application, plant gene improvement, etc., can solve problems such as violent reaction, environmental pollution, and increased production costs

Inactive Publication Date: 2014-11-19
陶飞
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the whole synthesis reaction, a large number of protecting groups are used, which increases the production cost
At the same time, the following problems normally exist: the productive rate is low, the reaction is violent, and there is environmental pollution

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Diguanylate cyclase gene, vector, engineering bacteria and application
  • Diguanylate cyclase gene, vector, engineering bacteria and application
  • Diguanylate cyclase gene, vector, engineering bacteria and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Genomic DNA extraction kit was used to extract the total genomic DNA of Xanthomonas campestris strain CCTCC NO: M2012464, using the genomic DNA as a template, under the action of primer 1 (GACTCTAGAACTTCACGACGAGAAGCTGGCGGTAG) and primer 2 (GACTCTAGAACCCATAATGGATAGGCAC) , for PCR amplification.

[0030] The amount of each component in the PCR reaction system (total volume 50 μL): 5 μL of 10×pfu DNA polymerase Buffer (Sigma), 1 μL of 10 mM dNTP mixture, 2 μL each of primer 1 and primer 2 at a concentration of 25 μL, 1 μL of genomic DNA, 1 μL of pfu DNA polymerase, deionized Water 28 μL.

[0031] PCR amplification conditions: 1) 95°C, denaturation for 5 min; 2) 95°C, denaturation for 1 min, annealing at 60°C for 45 s, extension at 72°C for 1.1 min, 30 cycles; 3) 72°C, extension for 10 min, and cooling to 4°C.

[0032] Take 5 μL of the PCR reaction solution and detect it by 0.8% agarose gel electrophoresis. The fragment was purified with a PCR purification kit, then treat...

Embodiment 2

[0034]Expression primer 3 (CACGGATCCTTGCCACACATCGAGGCCTGGAGCATCA) and primer 4 (CAGCTCGAGTCAAGAAATAGCCATACC) were designed according to the analysis results of Embodiment 1, and BamHI and XhoI restriction endonuclease sites were introduced in primer 3 and primer 4 respectively. Under primer 3 and primer 4, pfu DNA polymerase was used to amplify, and a 1034bp double guanylate cyclase fragment was obtained. After sequencing, the amplified fragment was treated with BamHI and XhoI restriction endonucleases , and use T4 DNA ligase to connect the fragment with pGEX-6p-1 treated with the same double enzymes to construct the expression vector pGEX-6p-dgcX. The constructed expression vector pGEX-6p-dgcX was electrotransformed into Escherichia coli BL21, plated and cultured overnight at 37°C, clones were randomly selected to extract plasmids, and PCR amplification was performed with primers 3 and 4 to amplify the target species The template plasmid with the band is the plasmid containin...

Embodiment 3

[0037] The recombinant Escherichia coli BL21 strain BL21 / pGEX-6p-dgcX verified in Example 2 containing the expression recombinant plasmid pGEX-6p-dgcX was cultivated to a cell concentration of OD600 with LB culture fluid containing 100 μg / ml kanamycin About 1.0, then add ITPG at a final concentration of 1 mM to the LB culture medium, induce culture for 8 hours, centrifuge at 8000 rpm for 5 minutes at 4°C, and collect bacterial cells containing recombinant diguanylate cyclase.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Gene lengthaaaaaaaaaa
Login to View More

Abstract

The invention provides a diguanylate cyclase gene for coding diguanylate cyclase, a recombinant vector containing the gene, recombinant gene engineering bacteria obtained by transformation of the recombinant vector, and application thereof in the preparation of recombinant diguanylate cyclase. The diguanylate cyclase can be bonded with an expression vector to construct intracellular expression recombinant plasmid containing the genes for respectively correspondingly transforming to escherichia coli to obtain recombinant escherichia coli. The recombinant escherichia coli containing the recombinant diguanylate cyclase can be used as an enzyme source for biological catalysis and transformation. The recombinant diguanylate cyclase as a transformation enzyme can use 5'-guanosine triphosphate (GTP) trisodium as a substrate for transformation for preparation of cyclic di-guanylic monophosphate (c-di-GMP).

Description

(1) Technical field [0001] The present invention relates to a gene encoding diguanylate cyclase, a recombinant vector containing the gene, a recombinant engineered bacterium obtained by transforming the recombinant vector, and preparation of diguanylate cyclase and biosynthesis of c-di-GMP aspects of application. (2) Background technology [0002] Cyclic guanosine diphosphate (c-di-GMP), as the second signal molecule of bacteria, is ubiquitous in various microorganisms, including pathogenic bacteria harmful to humans. In these microorganisms, c-di-GMP regulates the expression of virulence factors, biofilm formation, and antibiotic resistance (ref. in Qinghua). In acute and chronic bacterial infections and diseases, c-di-GMP plays a very important role. Therefore, c-di-GMP has a good prospect for drug development. [0003] Four patents have disclosed the application value of c-di-GMP. WO2005 / 030186 found that c-di-GMP can attenuate the toxicity of microbial pathogens and ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/60C12N9/88C12N1/20C12N15/63C12P19/36C12R1/64
Inventor 陶飞刘小杰陈礼明
Owner 陶飞
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com