Diguanylate cyclase gene, vector, engineering bacteria and application
A technology of double guanylate cyclase and guanylate cyclase, applied in genetic engineering, application, plant gene improvement, etc., can solve problems such as violent reaction, environmental pollution, and increased production costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Genomic DNA extraction kit was used to extract the total genomic DNA of Xanthomonas campestris strain CCTCC NO: M2012464, using the genomic DNA as a template, under the action of primer 1 (GACTCTAGAACTTCACGACGAGAAGCTGGCGGTAG) and primer 2 (GACTCTAGAACCCATAATGGATAGGCAC) , for PCR amplification.
[0030] The amount of each component in the PCR reaction system (total volume 50 μL): 5 μL of 10×pfu DNA polymerase Buffer (Sigma), 1 μL of 10 mM dNTP mixture, 2 μL each of primer 1 and primer 2 at a concentration of 25 μL, 1 μL of genomic DNA, 1 μL of pfu DNA polymerase, deionized Water 28 μL.
[0031] PCR amplification conditions: 1) 95°C, denaturation for 5 min; 2) 95°C, denaturation for 1 min, annealing at 60°C for 45 s, extension at 72°C for 1.1 min, 30 cycles; 3) 72°C, extension for 10 min, and cooling to 4°C.
[0032] Take 5 μL of the PCR reaction solution and detect it by 0.8% agarose gel electrophoresis. The fragment was purified with a PCR purification kit, then treat...
Embodiment 2
[0034]Expression primer 3 (CACGGATCCTTGCCACACATCGAGGCCTGGAGCATCA) and primer 4 (CAGCTCGAGTCAAGAAATAGCCATACC) were designed according to the analysis results of Embodiment 1, and BamHI and XhoI restriction endonuclease sites were introduced in primer 3 and primer 4 respectively. Under primer 3 and primer 4, pfu DNA polymerase was used to amplify, and a 1034bp double guanylate cyclase fragment was obtained. After sequencing, the amplified fragment was treated with BamHI and XhoI restriction endonucleases , and use T4 DNA ligase to connect the fragment with pGEX-6p-1 treated with the same double enzymes to construct the expression vector pGEX-6p-dgcX. The constructed expression vector pGEX-6p-dgcX was electrotransformed into Escherichia coli BL21, plated and cultured overnight at 37°C, clones were randomly selected to extract plasmids, and PCR amplification was performed with primers 3 and 4 to amplify the target species The template plasmid with the band is the plasmid containin...
Embodiment 3
[0037] The recombinant Escherichia coli BL21 strain BL21 / pGEX-6p-dgcX verified in Example 2 containing the expression recombinant plasmid pGEX-6p-dgcX was cultivated to a cell concentration of OD600 with LB culture fluid containing 100 μg / ml kanamycin About 1.0, then add ITPG at a final concentration of 1 mM to the LB culture medium, induce culture for 8 hours, centrifuge at 8000 rpm for 5 minutes at 4°C, and collect bacterial cells containing recombinant diguanylate cyclase.
PUM
Property | Measurement | Unit |
---|---|---|
Gene length | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap