Biosynthetic method, engineering strain and preparation method of α-lipoic acid

A technology of biosynthesis and engineering strains, applied in the field of biosynthesis of α-lipoic acid, which can solve problems such as product safety doubts, complicated processes, and environmental pollution

Active Publication Date: 2018-03-20
GUANGZHOU INST OF BIOMEDICINE & HEALTH CHINESE ACAD OF SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] Disadvantages of chemical synthesis to produce lipoic acid: cumbersome steps, complex process, and use of chemical raw materials, and a large amount of toxic catalysts are used in the synthesis process, the safety of the product is seriously questioned
At the same time, it causes serious pollution to the environment and is an environmentally non-friendly process

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Biosynthetic method, engineering strain and preparation method of α-lipoic acid
  • Biosynthetic method, engineering strain and preparation method of α-lipoic acid
  • Biosynthetic method, engineering strain and preparation method of α-lipoic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0145] A preparation method of an engineering strain for biosynthesizing α-lipoic acid, comprising the steps of:

[0146] (1) Construction of prokaryotic expression vector pET28-lipD

[0147] The plasmid pGS331 containing lipD and the expression vector pET28 were double digested with Nco I and Sal I, purified and recovered, and ligated with ligase to obtain the recombinant vector pET28-lipD, see Figure 1-A and Figure 1-B;

[0148] The recombinant vector pET28-lipD was detected by double enzyme digestion with Nco I and Sal I, which showed that the lipD gene fragment carried by pET28-lipD was consistent with that on pGS331. DNA sequencing and DNAstar software analysis showed that the protein encoded by lipD included the N-terminal 33 amino acid residues (1-33) and the middle 52 amino acid residues (238-289) of the E2 subunit of pyruvate dehydrogenase, a total of 85 amino acids Residue composition, which is a hybrid lipoic acid domain (Miles and Guest 1987); at the 3' end of the...

Embodiment 2

[0170] A preparation method of an engineering strain for biosynthesizing α-lipoic acid, comprising the steps of:

[0171] (1) Construction of the prokaryotic expression vector pET28-lipD: see step (1) of Example 1;

[0172] (2) Construction of the expression vector pSU18-lplA: refer to step (2) of Example 1;

[0173] (3) Preparation of recombinant vector pET28-lipD-lplA

[0174] A. Amplify the lipD gene fragment: refer to A in step (3) of Example 1;

[0175] B. Amplify the lplA gene fragment: refer to B in step (3) of Example 1;

[0176] C, referring to C in embodiment 1 step (3);

[0177] (4) Construction of recombinant vector pBAD34-lipA-SD-metK (see Figure 4 )

[0178] A. Construction of cloning vectors pMD19-T-lipA and pMD19-T-metK

[0179] Using the total DNA of wild-type Escherichia coli MG1655 as a template, the lipA gene and the metK gene were amplified by PCR, and respectively TA cloned and connected to the expression vector pMD19-T to obtain pMD19-T-lipA and p...

Embodiment 3

[0192] A preparation method of an engineering strain for biosynthesizing α-lipoic acid, comprising the steps of:

[0193] (1) Construction of the prokaryotic expression vector pET28-lipD: see step (1) of Example 1;

[0194] (2) Construction of the expression vector pSU18-lplA: refer to step (2) of Example 1;

[0195] (3) Construction of recombinant vector pET28-lipD-tac-lplA

[0196] In order to achieve an optimal balance between the expression levels of lplA and lipD, a tac promoter was added before lplA in this embodiment.

[0197] A. Amplify the tac promoter gene: use pfuDNA as a polymerase, plasmid pGS331 as a template, Ptacpromoterdown and Ptacpromoterup as primers, and PCR amplify to obtain a 105bp tac promoter gene;

[0198] Ptacpromoter up (upstream primer):

[0199] GTCTATGAATTCACTCCCCATCCCCCTGT (SEQ ID NO. 7);

[0200] Ptacpromoter down (downstream primer):

[0201] GAGCAGGCGTAATGTGGACATGGATCCTGTTTCCTG (SEQ ID NO. 8);

[0202] B. Amplify the lplA gene fragment:...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a biosynthesis method of α-lipoic acid, an engineering strain and a preparation method thereof. The biosynthesis method is as follows: cloning Escherichia coli lipD gene, lplA gene, metK gene and lipA lipoic acid synthase gene; constructing lipoic acid synthase gene Overexpression vector of octanoic acid domain protein; tandem cloning of lplA into a vector for high-efficiency expression domain protein to ensure complete octanoylation of domain protein; construction of lipA or tandem expression vector with metK; transform the above four vectors into suitable In Escherichia coli strains, media composition and culture conditions were adjusted and compared to promote the conversion of octanoylation domain proteins to lipoylation. The α-lipoic acid preparation method of the present invention has the advantages of combining low-value chemical raw materials with pure biological production methods, less toxic substances in the production process, and less environmental pollution. Its synthetic lipoic acid has high safety and high yield; the obtained α-lipoic acid activity is high.

Description

technical field [0001] The invention relates to the field of biosynthesis of active substances, in particular to a biosynthesis method of α-lipoic acid, an engineering strain and a preparation method thereof. Background technique [0002] α-lipoic acid is a biologically active natural substance, its chemical name is 1,2-dithiolane-3-pentanoic acid, and its structural formula is as Formula I. As a cofactor, it widely exists in organisms, and it is usually covalently bound to the ε-amino group of lysine in protein molecules in the form of amide bonds. Lipoic acid is optically active, R-(+)-α-lipoic acid (D-lipoic acid) is the natural form of lipoic acid in the human body, and S-(+)-α-lipoic acid is not active in the human body. [0003] [0004] Alpha-lipoic acid can be taken orally as a food, and is easily absorbed and utilized by biological tissues, and can pass through the blood-brain barrier to play the role of a so-called "universal antioxidant" with low toxicity. Th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/70C12N1/21C12P17/00C12R1/19
Inventor孙益嵘王海洪庞弘燊何伟
OwnerGUANGZHOU INST OF BIOMEDICINE & HEALTH CHINESE ACAD OF SCI