Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A method for rapid diagnosis of mulberry sclerotinia

A technology for rapid diagnosis and sclerotinia disease, applied in the field of plant disease control, to achieve the effects of convenient and quick use, avoiding economic losses, and accurate and reliable detection results

Inactive Publication Date: 2016-08-17
SOUTHWEST UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But so far, there are no research reports on the discovery of the specific conserved DNA sequence (or gene) of G. nucleatum and the rapid molecular diagnosis and identification method of the reduced Sclerotinia sclerotiorum at home and abroad.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for rapid diagnosis of mulberry sclerotinia
  • A method for rapid diagnosis of mulberry sclerotinia
  • A method for rapid diagnosis of mulberry sclerotinia

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1: Extraction of test material DNA. The aforementioned test strains were inoculated onto the PDA medium pasted with cellophane, and Sclerotinia, Botrytis cinerea and Trichoderma were cultivated in the dark at 20°C for 2 days, and the pathogenic bacteria of sclerotinia mulberry were grown at 25 Cultivate in the dark for 15 days and collect mycelium. Using the CTAB method ((Liu Li, Zhang Yongjun, Xu Changzheng, Luo Feng. An improved CTAB method to extract polysaccharide-producing fungal DNA. China Biotechnology Journal, 2014, 34(5): 75-79) to extract fungi and mulberry and other plants Genomic DNA of tissues and soil samples refer to Woodhall et al. cepivorumin soil. European Journal of Plant Pathology, 2012, 134(3): 467-473), the concentration and quality of all extracted DNA samples were compared by comparing the band intensity of agarose gel electrophoresis and measuring the 260 nm / 280 nm absorbance ratio for detection. The detected DNA samples were stored at...

Embodiment 2

[0026] Example 2: Acquisition of specific conserved DNA fragments of G. nuclei. First, RAPD (random amplified polymorphism DNA)-PCR technology was used to amplify and screen specific conserved DNA fragment sequences of G. nuclei. The 40 random primers used were synthesized by Shanghai Sangong. Refer to the reaction procedure of Williams et al. (Williams J G K, Kubelik A R, Liv S ak KJ, Rafalski J A, Tingey V. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Research, 1990, 18(22): 6531-6535) , the total PCR volume of each RAPD amplification reaction is 25 μL, including 2.5 μL 10×PCR Buffer; 1.5 μL Mg 2+ (25mmol / L); 2μL dNTPs (2.5mmol / L); 1μL 10mM random primer, 1μL DNA template, 0.25μL rTaq enzyme (2.5U / μL); 2 O make up. The amplification program was as follows: pre-deformation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 36°C for 30 s, extension at 72°C for 1.5 min, 35 cycles; final extension at 72°C for 10 min ...

Embodiment 3

[0030] Example 3: Design and screening of SCAR-specific primers. According to the sequence of the specific fragment, 20 pairs of SCAR primers were designed with Premier 5.0 software, and the designed primer pairs were synthesized by Shanghai Sangon Biotechnology Co., Ltd. These 20 pairs of primers were screened by PCR, and a pair of best specific primers SS-F / SS-R were screened from these primers. The forward sequence SS-F of the primer is 5'- AGTAAAGAGAACATCAAACTTCG -3', located at 8 bp-30 bp of the specific sequence; the reverse sequence SS-R is 5'- ACTTCC ACCGACCA ATCT -3', located at 580bp-596bp of the specific sequence , the target fragment is 590bp (see the underlined part in the sequence listing).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for rapidly diagnosing shrunken-fruitsclerotiniose of mulberry. Through the discovered pathogen scleromitrula shiraiana specificity conserved DNA sequence, a specificity SCAR-PCR primer is obtained and a shrunken-fruitsclerotiniose of mulberry SCAR-PCR diagnosis and detection method is established. The method is high in sensitivity (the detection sensitivity is 1pg / [mu]L, high in specificity, convenient and rapid to use and accurate and reliable in detection result, can be used for the field diagnosis of the shrunken-fruitsclerotiniose of mulberry and the detection of the mulberry bacteria carrying condition, and also can be used for the diagnosis of the disease incubation period (the mulberries are infected but the symptoms do not appear) so as to forecasting the diseases in an early stage, take necessary control measures in time, safely and effectively prevent and control the disease and lighten or avoid the economic loss. According to the method, the product such as a detection kit for the shrunken-fruitsclerotiniose of mulberry can be researched and developed; the method is widely applied to the scientific research and production practice of the industries related to mulberries.

Description

technical field [0001] The invention relates to the technical field of plant disease prevention and control, in particular to a method for rapidly diagnosing mulberry miniature sclerotinia by using molecular biology technology. Background technique [0002] Economic importance of sclerotinia mulberry. Shrunken-fruitsclerotiniose of mulberry is one of three sclerotinia diseases of mulberry and is caused by Scleromitrula shiraiana (Schuamacher T, Holst -Jensen A. A synopsis of thegenus Scleromitrula. Mycoscience, 1997, 38(1): 55-69), is the most common and most harmful sclerotinia in the world. The disease is very common in my country. It occurs in major fruit and mulberry planting areas such as Jiangsu, Zhejiang, Shanghai, Sichuan, Chongqing, Shaanxi and Taiwan. %; In recent years, the outbreak of Sclerotinia sclerotiorum in many areas has caused a large area of ​​fruit and mulberry production to be destroyed (Kuai Yuanzhang, Wu Fuan. A review of the pathogen and disease cont...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12Q1/04C12R1/645
CPCC12Q1/686C12Q1/6895C12Q2535/139
Inventor 谭万忠吴舒劼苏正川余洋毕朝位杨宇衡
Owner SOUTHWEST UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com