Supercharge Your Innovation With Domain-Expert AI Agents!

Kit for detecting gene mutation of EGFR and application of kit

A detection kit and gene technology, which is applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., and can solve the problems of complex operations, inability to be widely promoted, and high cost of sequencing methods

Inactive Publication Date: 2015-04-22
舒雄 +1
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the sequencing method is complicated to operate, expensive, and low in sensitivity, so it is difficult to be widely used in clinical practice.
In addition, some methods, such as fluorescent real-time polymerase chain reaction, high performance liquid chromatography and capillary electrophoresis, require special equipment, so they still cannot be widely promoted in clinical practice.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting gene mutation of EGFR and application of kit
  • Kit for detecting gene mutation of EGFR and application of kit
  • Kit for detecting gene mutation of EGFR and application of kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 Artificial construction of EGFR gene wild-type, del E746-A750 mutant, delL747-S752 mutant recombinant plasmids

[0028] The experimental steps are as follows:

[0029] (1) Collect blood samples from patients with confirmed EGFR gene wild-type, del E746-A750, and delL747-S752 mutations in the clinic, extract genomic DNA, and artificially design specific primers (with SalⅠ and XbaⅠ restriction sites at both ends). , the specific sequence is as follows:

[0030] SEQ ID NO: 34 Sense-1: AGGTCGACGGACTCTGGATCCCA

[0031] SEQ ID NO: 35 Reverse-2: TCTTCTAGACCAGCATGGGAGAGGC

[0032] Perform PCR amplification. The PCR reaction system is: Each 25 μL PCR reaction system includes: 12.5 μL of 2×Tag mix, forward and reverse primers are 10 μM and 10 μM respectively, template 40ng, and the rest is water. The reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 20S, annealing at 55°C for 10S, and extension at 72°C for 9S, a total of 35 cycles...

Embodiment 2

[0039] Example 2. Common PCR detection of the EGFR gene del E746-A750 mutant by the detection system

[0040] (1) Primer design

[0041] For the del E746-A750 mutation of the EGFR gene, the inventors designed a series of primers (primer sequences are shown in Table 1, and the framed bases in the sequence in the table indicate that the bases are phosphorylated). After the primer design is completed, the optimization of the detection system and the optimization of the amplification conditions, including the optimization of the annealing temperature, etc. are carried out.

[0042] Table 1 EGFR gene del E746-A750 mutation detection related primers

[0043]

[0044]

[0045] The results showed that the third group of specific primers was the best: wild type forward primer (SEQ ID NO: 7), mutant forward primer (SEQ ID NO: 8), common reverse primer (SEQ ID NO: 9) . The optimal reaction system is: Each 25 μL PCR reaction system includes: 12.5 μL of 2×Tag mix, three specific p...

Embodiment 3

[0048] Example 3 Determination of Sensitivity of EGFR Gene del E746-A750 Mutation Detection System

[0049] (1) Dilute the delE746-A750 mutant recombinant plasmid to 10 7 -10 copy number for use

[0050] (2) Using the diluted recombinant plasmid as a template and the specific primers described in Example 2 as a primer set (SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9) to carry out common PCR. The reaction system is: Each 25 μL PCR reaction system includes: 12.5 μL of 2×Tag mix, three specific primers of 10 μM, 10 μM, and 10 μM respectively, 40 ng of template, and the rest is water. The PCR reaction conditions were: pre-denaturation at 95°C for 5min; denaturation at 95°C for 20S, annealing at 57°C for 10S, extension at 72°C for 9S, a total of 35 cycles; and finally 5min at 72°C.

[0051] (3) Separation of amplified products by agarose gel electrophoresis (results such as figure 2 shown), the results showed that the detection sensitivity of the detection system to the delE74...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit for detecting the gene mutation of EGFR and application of the kit. Specific primers are designed according to different gene mutations of the EGFR and are modified relatively, and whether related mutations of the EGFR exists is judged through an amplification curve and a solubility curve by adopting sample DNA as a template combined with real-time quantitative PCR (polymerase chain reaction). The kit provided by the invention and a method for detecting a mutant site have high sensitivity and specificity, can be used for detecting trace mutation and have good clinical application value.

Description

technical field [0001] The invention belongs to the field of gene detection, relates to medical diagnosis and biotechnology, in particular to a kit for detecting EGFR gene mutation and its application. Background technique [0002] The epidermal growth factor receptor family (EGFR) belongs to the tyrosine kinase receptor family, and the signal transduction pathway mediated by it regulates the growth, proliferation and differentiation of cells. Various mutations in the EGFR tyrosine kinase region are often found in cancer, and these mutations are closely related to the efficacy of tyrosine kinase inhibitors. Therefore, the detection of EGFR gene mutation has important reference value for the individualized treatment of cancer. [0003] The EGFR family consists of four members, namely erbB1 (EGFR / HER1), erbB2 (neu / HER2), erbB3 (HER3), and erbB4 (HER4). EGFR family members are similar in structure, including extracellular region, transmembrane region and intracellular region....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6886C12Q2600/118C12Q2600/156
Inventor 刘辉琦潘韵芝舒雄
Owner 舒雄
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More