Kit for detecting gene mutation of EGFR and application of kit
A detection kit and gene technology, which is applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., and can solve the problems of complex operations, inability to be widely promoted, and high cost of sequencing methods
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1 Artificial construction of EGFR gene wild-type, del E746-A750 mutant, delL747-S752 mutant recombinant plasmids
[0028] The experimental steps are as follows:
[0029] (1) Collect blood samples from patients with confirmed EGFR gene wild-type, del E746-A750, and delL747-S752 mutations in the clinic, extract genomic DNA, and artificially design specific primers (with SalⅠ and XbaⅠ restriction sites at both ends). , the specific sequence is as follows:
[0030] SEQ ID NO: 34 Sense-1: AGGTCGACGGACTCTGGATCCCA
[0031] SEQ ID NO: 35 Reverse-2: TCTTCTAGACCAGCATGGGAGAGGC
[0032] Perform PCR amplification. The PCR reaction system is: Each 25 μL PCR reaction system includes: 12.5 μL of 2×Tag mix, forward and reverse primers are 10 μM and 10 μM respectively, template 40ng, and the rest is water. The reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 20S, annealing at 55°C for 10S, and extension at 72°C for 9S, a total of 35 cycles...
Embodiment 2
[0039] Example 2. Common PCR detection of the EGFR gene del E746-A750 mutant by the detection system
[0040] (1) Primer design
[0041] For the del E746-A750 mutation of the EGFR gene, the inventors designed a series of primers (primer sequences are shown in Table 1, and the framed bases in the sequence in the table indicate that the bases are phosphorylated). After the primer design is completed, the optimization of the detection system and the optimization of the amplification conditions, including the optimization of the annealing temperature, etc. are carried out.
[0042] Table 1 EGFR gene del E746-A750 mutation detection related primers
[0043]
[0044]
[0045] The results showed that the third group of specific primers was the best: wild type forward primer (SEQ ID NO: 7), mutant forward primer (SEQ ID NO: 8), common reverse primer (SEQ ID NO: 9) . The optimal reaction system is: Each 25 μL PCR reaction system includes: 12.5 μL of 2×Tag mix, three specific p...
Embodiment 3
[0048] Example 3 Determination of Sensitivity of EGFR Gene del E746-A750 Mutation Detection System
[0049] (1) Dilute the delE746-A750 mutant recombinant plasmid to 10 7 -10 copy number for use
[0050] (2) Using the diluted recombinant plasmid as a template and the specific primers described in Example 2 as a primer set (SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9) to carry out common PCR. The reaction system is: Each 25 μL PCR reaction system includes: 12.5 μL of 2×Tag mix, three specific primers of 10 μM, 10 μM, and 10 μM respectively, 40 ng of template, and the rest is water. The PCR reaction conditions were: pre-denaturation at 95°C for 5min; denaturation at 95°C for 20S, annealing at 57°C for 10S, extension at 72°C for 9S, a total of 35 cycles; and finally 5min at 72°C.
[0051] (3) Separation of amplified products by agarose gel electrophoresis (results such as figure 2 shown), the results showed that the detection sensitivity of the detection system to the delE74...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
