Metalloprotease from exiguobacterium

A protease activity, protein technology, applied in the direction of enzymes, peptidases, hydrolases, etc., can solve the problem of limited use of metalloproteases

Inactive Publication Date: 2015-05-13
NOVOZYMES AS
View PDF132 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the use of metalloproteases in washing and cleaning processes and in detergents is limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Metalloprotease from exiguobacterium
  • Metalloprotease from exiguobacterium
  • Metalloprotease from exiguobacterium

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0352] Example 1. Sequencing of the deep-sea microbacterium genome

[0353] A novel bacterial strain was isolated from marine environmental samples collected in Denmark and designated as Exiguobacterium deep-sea, representing a new species within the genus Exigrebacterium.

[0354] Chromosomal DNA of this strain was isolated by QIAamp DNA Blood Mini Kit (QIAamp DNA Blood Mini Kit " (Qiagen, Hilden, Germany). 2 ug of chromosomal DNA was subjected to partial shotgun genome sequencing, a method in FASTERIS SA, Switzerland's commercially available service.By carrying out homology search with the known example of M4 metalloprotease, analyze the genome sequence of the protein sequence of coding this M4 metalloprotease and identify a kind of gene (SEQ ID NO: 1).

[0355] The nucleotide sequence and deduced amino acid sequence of the Exiguobacterium deep-sea gene are shown in SEQ ID NO:1. The coding sequence is 1536 bp including the stop codon. The encoded predicted protein is 511 ...

example 2

[0356] Example 2: Construction of the Bacillus subtilis expression strain comprising the deep-sea microbacterium genome sequence of the M4 metalloprotease polypeptide encoding SEQ ID NO:2

[0357] Cloning and expression of protease

[0358]As described in WO 99 / 43835 (hereby incorporated by reference), the signal peptide of the alkaline protease (aprH) from Bacillus clausii was fused in-frame to the DNA encoding the protease by SOE PCR fusion, thereby replacing Natural signal peptide. To amplify the coding DNA, the genomic DNA of Exiguobacterium was used as a template and the oligos SEQ ID NO:3 and SEQ ID NO:4 were used to amplify the gene by PCR, where the underlined sequence corresponds to the gene sequence And the sequence not underlined corresponds to the SOE expression cassette.

[0359] Forward primer GTTCATCGATCGCATCGGCT GAAGGTCTTCAATCTGGTAAG

[0360] (SEQ ID NO 3)

[0361] reverse primer GCGTTTTTTTATTGATTAACGCGT TTAGTAGACGCCAACTGC

[0362] (SEQ ID NO 4)

[...

example 3

[0384] Example 3: Purification of M4 Metalloprotease with SEQ ID NO:2

[0385] (The M4 protease was expressed in Bacillus subtilis.)

[0386] The broth was centrifuged (20000 x g, 20 min) and the supernatant was carefully decanted from the precipitate. The supernatant was filtered through a Nalgene 0.2 μm filter unit to remove remaining Bacillus host cells. The solid (NH 4 ) 2 SO 4 Added to the 0.2μm filtrate to a final concentration of 1.2M (NH 4 ) 2 SO 4 And the pH was adjusted to pH 6.9 with 3M Tris-base. The M4 protease solution was applied in 20mM HEPES / NaOH, 2mM CaCl 2 , 1.2M (NH 4 ) 2 SO 4 , on a Phenyl Sepharose FF (High Substitution) column (from GE Healthcare) equilibrated in pH 7. After washing the column well with equilibration buffer, M4 protease was treated with a linear gradient in equilibration buffer with 20mM HEPES / NaOH with 25% (v / v) 2-propanol, 2mM CaCl 2 , pH 7 was eluted over 3 column volumes. Fractions from this column were analyzed for pro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a new metalloprotease derived from Exiguobacterium and the use thereof in cleaning processes, such as laundry and dish wash. The invention also relates to detergent compositions and cleaning compositions comprising Exiguobacterium oxidotolerans metalloprotease.

Description

[0001] References to Sequence Listings [0002] This application contains a Sequence Listing in computer readable form. This computer readable form is hereby incorporated by reference. field of invention [0003] The present invention relates to cleaning and / or detergent compositions comprising a metalloprotease (E.C 3.4.24). The present invention further relates to novel metalloproteases from the genus Exiguobacterium and their use in cleaning processes such as dishwashing and laundry washing. In addition, the present invention relates to methods of performing cleaning such as dishwashing and laundry. Background of the invention [0004] For more than 30 years, the detergent industry has employed different enzymes in detergent formulations, the most commonly used enzymes include proteases, amylases and lipases, each suitable for removing different types of soils. Detergent compositions typically include a complex combination of ingredients in addition to these enzymes. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/54
CPCC12N9/52C12Y304/24C12N15/75C11D3/38681C11D3/386
InventorA·贝尼P·R·厄斯特加德M·哥杰曼森M·S·博彻特
OwnerNOVOZYMES AS