Chitin deacetylase, and construction method and application thereof

A deacetylase and construction method technology, applied in the direction of microorganism-based methods, applications, botany equipment and methods, etc., can solve the problems of uniformity, high alkali consumption, and inability to obtain quality

Inactive Publication Date: 2015-05-20
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, the industrial production of chitosan generally adopts the strong alkali thermochemical method. There are many defects and deficiencies in the production of chitosan by this method, mainly including the following aspects: the production process consumes a lot of energy, consumes a large amount of strong alkali, and seriously pollutes the environment. , Chitosan with uniform quality and specific deacetylation degree cannot be obtained, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chitin deacetylase, and construction method and application thereof
  • Chitin deacetylase, and construction method and application thereof
  • Chitin deacetylase, and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1: Cloning of Bacillus cereus chitin deacetylase gene

[0026] Primers were designed to amplify the chitin deacetylase (CDA) of B. cereus ATCC10987 based on the sequence information annotated as chitin deacetylase (CDA) in 13 B. cereus genome sequences provided by NCBI Gene. Primers are:

[0027] BcCDA-dF: ATGTTTTTCTTTTTTTATTACGAG

[0028] BcCDA-dR: TTATTGAACATCTTTACTTTTCG

[0029] B. cereus ATCC10987 was used as a template.

[0030] The PCR reaction system is: template 1 μL; 5 μL 10×PCR buffer, 2 μL dNTP (10 mmol / L), 2 μL primer BcCDA-dF (10 μmol / L), 2 μL primer BcCDA-dR (10 μmol / L), 1 μL Taq DNA polymerase ( 5U / μL), add ddH2O to make up to 50 μL. PCR reaction conditions: pre-denaturation at 95°C for 5min; denaturation at 95°C for 30s, annealing at 55°C for 30s, extension at 72°C for 2min, 30 cycles; extension at 72°C for 10min. Use 1% agarose gel electrophoresis to perform electrophoresis analysis on the PCR amplification products, cut the gel of the PCR...

Embodiment 2

[0050] Embodiment 2: In vitro recombinant expression, isolation and purification and biological activity analysis of Bacillus cereus BcCDA gene.

[0051] In vitro recombinant construction method:

[0052] 1. Construct chitin deacetylase recombinant expression vector;

[0053] 2. Introducing the recombinant expression vector obtained in step 1) into the Escherichia coli host cell, performing induced expression, and obtaining the expression product;

[0054] 3. Separation and purification of the recombinant protein obtained in step 2), namely chitin deacetylase.

[0055] In step 1), the expression vector can be pCT7-CHISP6H.

[0056] In step 2), the host cell is Escherichia coli BL21(DE3).

[0057] In step 3), the separation and purification method can be metal ion affinity chromatography

[0058] Construction of recombinant expression vector pCT7-CHISP6H-BcCDA

[0059] After online analysis (http: / / smart.embl-heidelberg.de / ) of the deduced amino acid sequence characteristi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a chitin deacetylase, and an expression gene and an application thereof The amino acid sequence of chitin deacetylase BcCDA is represented by SEQ ID NO.2; and the nucleotide sequence of the BcCDA expression gene is represented by SEQ ID NO.1. An engineering strain constructed by using the gene can efficiently secrete and express the chitin deacetylase BcCDA. A recombinant protein with biological activity is obtained after affinity chromatography one-step purification, and the recombinant protein can degrade solid plate generated yellow green 4-nitroaniline with 4-nitroacetanilide as a substrate. Cloning of the chitin deacetylase gene and the successful preparation of the recombinant protein with biological activity are of great theoretic and practical significance to deep development and high value utilization of the chitin resource.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, in particular to a chitin deacetylase and its construction method and application. Background technique [0002] Chitin is a polymer composed of N-acetylglucosamine connected by β-1,4 glycosidic bonds. It is a very important class of natural polysaccharides, and its quantity is second only to the most abundant resource in the world. Cellulose, but its utilization value is higher than that of cellulose, is the second largest nitrogen-containing organic compound in nature, and is called the world's sixth vital element by European and American academic circles. Chitin exists in the shells of many arthropods such as shrimps and crabs; chitin is also abundant in the body surface and digestive tract of insects and animals. [0003] It is estimated that the biosynthesis of chitin in nature exceeds 100 billion tons, and the amount of chitin required by humans is as high as 3.7×10 4 tons, ma...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/80C12N15/55C12N15/70C12P19/26C12R1/085
CPCC12N9/80C12P19/26
Inventor张继泉桂天书孙玉英王婧相建海
OwnerINST OF OCEANOLOGY - CHINESE ACAD OF SCI