A kind of xylanase, its coding gene xyn-lxy and application thereof

A xylanase and gene technology is applied in the field of xylanase to achieve the effects of ensuring product specificity, high production efficiency and ensuring amplification efficiency

Inactive Publication Date: 2017-11-03
ZHEJIANG UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the diversity of enzymatic hydrolysis products and the yield of xylose, there is currently no enzyme (series) that specializes in the production of xylooligosaccharides on the market.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of xylanase, its coding gene xyn-lxy and application thereof
  • A kind of xylanase, its coding gene xyn-lxy and application thereof
  • A kind of xylanase, its coding gene xyn-lxy and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0038] 1. Cloning of xyn-lxy gene and construction of recombinant plasmid pET-30a / xyn-lxy

[0039] Cloning and expression strategy of xyn-lxy xylanase gene figure 1 As shown, the method is as follows:

[0040] ① Design primers containing two restriction enzyme sites, EcoRI and XhoI:

[0041] LXY-F: 5'CCG GAATTC ATGATCTTCGCCCAGTGCGG 3', the nucleotide sequence is shown in SEQ ID No.2,

[0042] LXY-R: 5'CCG CTCGAG TTATACCAGCTTGGCGTTACCAA 3', the nucleotide sequence is shown in SEQ ID No.3.

[0043] ②PCR amplify the positive plasmid containing xyn-lxy gene in the Fosmid library, the amplification system is as follows:

[0044]

[0045] Vortex to mix well, centrifuge slightly and put into PCR machine. The amplification conditions of the xyn-lxy gene are as follows:

[0046]

[0047]

[0048] For PCR results, see figure 2 , a 1923bp band was amplified, and no other bands appeared in the swimming lane, indicating that the specificity of the designed primers was ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention belongs to the field of genetic engineering and in particular relates to xylanase as well as an encoding gene xyn-lxy and application thereof. The nucleotide sequence of xyn-lxy, serving as a xylanase gene, for encoding the xylanase is shown as SEQ ID No.1. An inventor successfully clones the xylanase by virtue of a design primer, the xylanase is successfully expressed in a prokaryotic expression system, a product obtained by virtue of induction ultrasonic purification is reacted with beech-xylan, and shown by a liquid chromatographic analysis result of an enzymatic hydrolysate, after reaction for 96h, the products only include xylobiose and xylose. According to the xylanase, the encoding gene and the application disclosed by the invention, when reaction begins, xylotriose occurs but is completely degraded after reaction for 4h, the hydrolysis efficiencies of the xylobiose and the xylose are finally stabilized at 0.25100mg / U and 0.07559mg / U; the hydrolysate of the xyn-lxy xylanase is mainly the xylobiose, and in addition, the xylobiose is high in yield and very suitable for being used as tools for developing functional health products in industry.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and specifically relates to a xylanase, its coding gene xyn-lxy and application thereof. Background technique [0002] Xylan is the main component of plant cell wall hemicellulose, which is abundant in nature. Plant fiber accounts for a considerable proportion in both the daily diet of humans and the composition of livestock and poultry diets. However, the lack of hemicellulose-degrading enzymes in the digestive tract of humans and monogastric animals cannot effectively degrade xylan, thus increasing the viscosity of chyme in the digestive tract and interfering with the absorption and utilization of nutrients by the small intestinal villi. The rumen of ruminants contains a large number of microorganisms, which have a certain ability to degrade xylan, and are an important source of discovery for obtaining new xylanases. At present, a large number of microorganisms encoding xylanase genes have b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/42C12N15/56C12N15/70C12N1/21A23K20/189C12N15/11
CPCA23K20/189C12N9/248
Inventor 王佳堃罗阳何波刘建新
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap