A kind of xylanase, its coding gene xyn-lxy and application thereof
A xylanase and gene technology is applied in the field of xylanase to achieve the effects of ensuring product specificity, high production efficiency and ensuring amplification efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0038] 1. Cloning of xyn-lxy gene and construction of recombinant plasmid pET-30a / xyn-lxy
[0039] Cloning and expression strategy of xyn-lxy xylanase gene figure 1 As shown, the method is as follows:
[0040] ① Design primers containing two restriction enzyme sites, EcoRI and XhoI:
[0041] LXY-F: 5'CCG GAATTC ATGATCTTCGCCCAGTGCGG 3', the nucleotide sequence is shown in SEQ ID No.2,
[0042] LXY-R: 5'CCG CTCGAG TTATACCAGCTTGGCGTTACCAA 3', the nucleotide sequence is shown in SEQ ID No.3.
[0043] ②PCR amplify the positive plasmid containing xyn-lxy gene in the Fosmid library, the amplification system is as follows:
[0044]
[0045] Vortex to mix well, centrifuge slightly and put into PCR machine. The amplification conditions of the xyn-lxy gene are as follows:
[0046]
[0047]
[0048] For PCR results, see figure 2 , a 1923bp band was amplified, and no other bands appeared in the swimming lane, indicating that the specificity of the designed primers was ...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap