Disulfide bond isomerase gene Trpdi2 from Trichoderma reesei and application thereof

A technology of disulfide bond isomerase and Trichoderma reesei, which is applied in the field of biochemical engineering and microbial genetic engineering, can solve the problems of heavy load, lack of endoplasmic reticulum tool enzyme enzymes, protein misfolding and assembly, etc., to increase production Effect

Inactive Publication Date: 2015-06-10
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] When a large amount of endogenous or exogenous proteins are expressed, the post-translational process of Trichoderma reesei is overloaded, resulting in a relative lack of enzymes in the endoplasmic reticulum, which will cause protein misfolding and assembly

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Disulfide bond isomerase gene Trpdi2 from Trichoderma reesei and application thereof
  • Disulfide bond isomerase gene Trpdi2 from Trichoderma reesei and application thereof
  • Disulfide bond isomerase gene Trpdi2 from Trichoderma reesei and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1: Cloning of Disulfide Bond Isomerase Gene

[0037] (1) Cloning of Trpdi2 Genomic DNA

[0038] According to the sequence information such as SEQ ID: 1 in the Trichoderma reesei data (http: / / genome.jgi-psf.org / Trire2 / Trire2.home.html), design relevant primers, the primer sequence is:

[0039] Trpdi2-F: ATGGTCTTGATCAAGAGCCTC,

[0040] Trpdi2-R: TCACAGCTCGTCCTTCTGG,

[0041] Using the genomic DNA of the QM9414 strain stored at -20°C as a template, PCR amplification was performed to obtain the full-length DNA fragment of the gene, which was cloned into the pGEM-T vector.

[0042] Wherein, the PCR reaction system is:

[0043]

[0044]

[0045] The PCR reaction conditions are:

[0046]

[0047] (2) Cloning of Trpdi2 cDNA

[0048] Using the cDNA of QM9414 strain stored at -80°C as a template, the cDNA fragment was amplified by PCR with primers Trpdi2-F and Trpdi2-R, and cloned into pGEM-T vector.

[0049] in,

[0050] The PCR reaction system is:

[00...

Embodiment 2

[0054] Example 2: Expression and Activity Measurement of Disulfide Bond Isomerase

[0055] (1) Expression vector construction of disulfide bond isomerase gene Trpdi2

[0056] According to the sequence of the disulfide bond isomerase gene Trpdi2, primers with restriction sites at the end were designed, and the cDNA of the QM9414 strain stored at -80°C was used as a template to perform PCR amplification to obtain the cDNA containing the sequence of the disulfide bond isomerase gene Trpdi2 DNA fragments, DNA fragments recovered by NcoI and BamHI double enzyme digestion and the pET-24d vector preserved in our laboratory, such as figure 1 shown. The two restriction fragments were recovered and ligated to obtain an expression vector, and the obtained expression vector was transformed into Escherichia coli DH5α. The transformed Escherichia coli DH5α was sequenced and detected, and the sequenced detection proved that the transformed DH5α was correct, and the extracted plasmid was tr...

Embodiment 3

[0065] Example 3: Effect of Disulfide Bond Isomerase on Exoglucanase Activity

[0066] (1) Effect of disulfide bond on the activity of exoglucanase CBH1 protein

[0067] Using Trichoderma reesei fermentation liquid as a sample, CBH1 pure protein was separated and purified by DEAE protein chromatography column. CBH1 was treated with different concentrations of DTT, and the activity of CBH1 protein was measured after 1, 2, 3, 4, 5, 6 and 18 hours of treatment. The activity was determined based on the activity of the substrate pNPC. Such as Figure 4 As shown, the left side is the SDS polyacrylamide gel electrophoresis image of the purified CBH1 protein sample, and the right side is the result graph of CBH1 activity after DTT treatment for different time, in which three curves represent the pNPC enzyme activity of CBH1 after different time treatment, With the treatment time of DTT, the activity of CBH1 enzyme decreased; with the increase of DTT treatment concentration, the acti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a disulfide bond isomerase gene Trpdi2 from Trichoderma reesei and application thereof. The disulfide bond isomerase gene separated from Trichoderma reesei has a polynucleotide sequence of (a) (b) or (c): (a) a polynucleotide sequence shown as SEQ ID No.1; (b) a polynucleotide sequence complementary with the polynucleotide sequence in (a) according to the principle of complementary base pairing; and (c) a cDNA sequence of the polynucleotide sequence (a)shown in the SEQ ID NO.1 or (b) polynucleotide sequence: a polynucleotide sequence shown in SEQ ID NO.2. The invention also obtains disulfide isomerase the from the encoding of the disulfide bond isomerase gene separated from the Trichoderma reesei and verifies the application of disulfide isomerase.

Description

technical field [0001] The invention relates to the fields of biochemical engineering and microbial genetic engineering, in particular to a disulfide bond isomerase gene Trpdi2 derived from Trichoderma reesei and its application. Background technique [0002] Due to the cellulase resources and their cellulase production capacity, filamentous fungi have received great attention in the past few decades, but with the development of industry and biomedicine, people hope to use filamentous fungi with strong secretion ability Fungi act as cell factories to more efficiently produce endogenous and exogenous proteins. [0003] Compared with other expression receptors, filamentous fungi have greater advantages as expression receptors of foreign proteins. Compared with prokaryotic expression hosts, filamentous fungi can perform post-translational processing of foreign proteins such as disulfide bond formation, glycosylation, and protease cleavage; compared with yeast, the glycosylatio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/61C12N9/90C12N15/63
Inventor张东远
OwnerTIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI