A broad-spectrum and high-efficiency antimicrobial peptide pb-cath-oh1 and its gene, preparation method and application
An antimicrobial peptide, coding gene technology, applied in the field of biomedicine, to achieve the effects of low cytotoxicity, strong antibacterial activity, convenient chemical synthesis and genetic engineering preparation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0020] Specific embodiments of the present invention will be described in detail below in conjunction with technical solutions, but the content of the present invention is not limited thereto.
[0021] Strictly follow the kit instructions, using RNeasy AxyPrep TM Multisource Total RNA Miniprep Kit (Qiagen, union city, CA, USA) was used to extract the total RNA from Burmese python lung tissue, and then use Creator TM SMART TMThe cDNA Library Construction Kit was used to construct the cDNA library of Burmese python lung tissue. Use the PowerScript Reverse Transcriptase in the kit to reverse transcribe and synthesize the first strand of cDNA. The primers are:
[0022] Forward SMARTⅣOligonucleotide primer:
[0023] 5'–AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG–3'
[0024] Reverse CDSⅢ / 3'PCR primer: 5'–ATTCTAGAGGCCGAGGCGGCCGACATG-d(T) 30 N -1 N–3’ (N=A, C, G, or T; N -1 = A, G, or C).
[0025] Use Advantage DNA Polymerase to synthesize the second strand of cDNA. The primer i...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



