Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

A broad-spectrum and high-efficiency antimicrobial peptide pb-cath-oh1 and its gene, preparation method and application

An antimicrobial peptide, coding gene technology, applied in the field of biomedicine, to achieve the effects of low cytotoxicity, strong antibacterial activity, convenient chemical synthesis and genetic engineering preparation

Active Publication Date: 2017-12-26
DALIAN UNIV OF TECH
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is no report on the research and application of cathelicidin host defense peptide from Burmese python

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A broad-spectrum and high-efficiency antimicrobial peptide pb-cath-oh1 and its gene, preparation method and application
  • A broad-spectrum and high-efficiency antimicrobial peptide pb-cath-oh1 and its gene, preparation method and application
  • A broad-spectrum and high-efficiency antimicrobial peptide pb-cath-oh1 and its gene, preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0020] Specific embodiments of the present invention will be described in detail below in conjunction with technical solutions, but the content of the present invention is not limited thereto.

[0021] Strictly follow the kit instructions, using RNeasy AxyPrep TM Multisource Total RNA Miniprep Kit (Qiagen, union city, CA, USA) was used to extract the total RNA from Burmese python lung tissue, and then use Creator TM SMART TMThe cDNA Library Construction Kit was used to construct the cDNA library of Burmese python lung tissue. Use the PowerScript Reverse Transcriptase in the kit to reverse transcribe and synthesize the first strand of cDNA. The primers are:

[0022] Forward SMARTⅣOligonucleotide primer:

[0023] 5'–AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG–3'

[0024] Reverse CDSⅢ / 3'PCR primer: 5'–ATTCTAGAGGCCGAGGCGGCCGACATG-d(T) 30 N -1 N–3’ (N=A, C, G, or T; N -1 = A, G, or C).

[0025] Use Advantage DNA Polymerase to synthesize the second strand of cDNA. The primer i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A broad-spectrum high-efficiency antimicrobial peptide Pb-CATH-OH1 and its gene, preparation method and application, which are straight-chain polypeptides, sequence: lysine-arginine-phenylalanine-lysine-lysine- Phenylalanine‑Phenylalanine‑Arginine‑Lysine‑Isoleucine‑Lysine‑Lysine‑Glycine‑Phenylalanine‑Arginine‑Lysine‑Isoleucine ‑Phenylalanine‑Lysine‑Lysine‑Threonine‑Lysine‑Isoleucine‑Phenylalanine‑Isoleucine‑Glycine‑Glycine‑Threonine‑Isoleucine‑ Proline‑Isoleucine. The precursor gene consists of 528 nucleotides, nucleotides 433‑525. It is rich in basic amino acids, small in molecular weight, simple in structure, has extremely strong broad-spectrum antimicrobial activity, is active against Gram-positive bacteria, Gram-negative bacteria and fungi, has low hemolysis, and is not easy to produce drug resistance. It is prepared as an additive Drugs, cosmetics, food and feed for anti-pathogenic microbial infection.

Description

technical field [0001] The present invention provides a cathelicidin family broad-spectrum antimicrobial peptide Pb-CATH-OH1 derived from Burmese python (Python molurus bivittatus) and its encoding gene, amino acid sequence and its daily chemical additives in cosmetics, health products, food, feed and the like. The application in the field of anti-infection medicine belongs to the field of biomedical technology. Background technique: [0002] Cathelicidin is a kind of multifunctional host antibacterial peptide family composed of N-terminal signal peptide region, intermediate conservative cathelin domain and C-terminal highly specific mature peptide region. The structural characteristics are: N-terminal signal peptide region (30 residues bases), an intermediate conserved cathelin domain (99-114 residues) and a highly specific mature peptide region at the C-terminus (12-100 residues). Cathelicidin has broad-spectrum antibacterial activity and can quickly and broadly kill a va...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/46C12N15/12A61K38/17A61P31/04A61K8/64A23L33/18A23K10/18
Inventor 于海宁王义鹏蔡莎莎刘雪莲王晨
Owner DALIAN UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com