P-nitrophenylalanine multi-locus introduction human tumor necrosis factor-alpha

A technology of tumor necrosis factor and nitrophenylalanine, which is applied in the field of preparation of hTNF-α mutant protein, and can solve the problems of long-term repeated use, hypersensitivity reaction, large dosage and the like

Inactive Publication Date: 2015-07-08
CHINA PHARM UNIV
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

TNF-α antagonists currently used clinically include TNF-α monoclonal antibodies and TNF-α soluble receptors, but these drugs have disadvantages such as large dosage, easy to cause hypersensitivity reactions, and long-term repeated use

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • P-nitrophenylalanine multi-locus introduction human tumor necrosis factor-alpha
  • P-nitrophenylalanine multi-locus introduction human tumor necrosis factor-alpha
  • P-nitrophenylalanine multi-locus introduction human tumor necrosis factor-alpha

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1: Construction of expression plasmids for hTNF-α and its mutants

[0048] 1) Construction of prototype hTNF-α gene

[0049] Primers for Overlap PCR were designed as follows:

[0050] 1 AGCATGCCATGGTGCGTAGCAG 22

[0051] 2 CGACAACATGCGCCACCGGCTAATCCGACGGGGTACGCGAGCTGCTACGCACCATGGC 58

[0052] 3 GGTGGCGCATGTTGTCGCGAATCCGCAAGCGGAAGGCCAACTTCAGTGGCTGAATCGT 58

[0053] 4 CGCAGTTCCACGCCATTCGCCAGCAGCGCATTCGCACGACGATTCAGCCACTGAAGTT 58

[0054] 5 AATGGCGTGGAACTGCGTGATAATCAGCTGGTGGTGCCGTCTGAAGGCCTGTATCTGA 58

[0055] 6 TGGACAGCCCTGACCTTTGAACAGCACCTGGCTATAAATCAGATACAGGCCTTCAGAC 58

[0056] 7 AAAGGTCAGGGCTGTCCAAGTACCCATGTGCTGCTGACCCATACCATTAGTCGTATTG 58

[0057] 8 GCTAAGCAGATTCACTTTGGTCTGCTAGCTCACCGCAATACGACTAATGGTATGGGTC 58

[0058] 9 GACCAAAGTGAATCTGCTTAGCGCGATTAAAAGCCCGTGCCAGCGTGAAACCCCGGAA 58

[0059] 10 CCAAGATAAATCGGTTCATACCACGGTTTCGCTTCCGCACCTTCCGGGGTTTCACGCT 58

[0060] 11 TGGTATGAACCGATTTATCTTGGCGGCGTGTTTCAGTTGGAAAAAGGCGATCGTTTGA 58

[0061] 12 CGCAAAATCC...

Embodiment 2

[0092] Example 2: Expression of hTNF-α and its mutants

[0093] 1) Obtaining strains containing hTNF-α mutant expression plasmids.

[0094] pNO 2 Phe 11 - hTNF-α, pNO 2 Phe 87 -hTNF-α and pNO 2 Phe 11,87 - hTNF-α expression plasmid (ampicillin resistance) and pNO 2 Phe-tRNA / RS plasmid (chloramphenicol resistance) was co-transformed into E.coli DH10B competent cells, and ampicillin and chloramphenicol double resistance plates were spread to screen positive clones.

[0095] 2) Expression of hTNF-α mutant.

[0096]Cultivate the seed liquid of the above strains in LB medium overnight, and expand the culture at a ratio of 1:100 the next day until the addition of unnatural amino acid pNO 2 Phe's M9 medium (Na 2 HPO 4 ·H 2 O 0.35% (w / v), KH 2 PO 4 0.34% (w / v), NH 4 Cl0.27% (w / v), Na 2 SO 4 0.07% (w / v), glycerol 1.5% (v / v), sodium succinate 0.57% (w / v), 0.1M CaCl 2 solution 0.1% (v / v), 0.2M MgSO 4 solution 0.5% (v / v)), when OD 600 When it reached 0.6, samples were t...

Embodiment 3

[0099] Example 3: Purification of hTNF-α and its mutants

[0100] 1) Sample pretreatment.

[0101] The obtained bacterial cell pellet was resuspended in Ni-NTA binding buffer (20mM Tris-HCl, 0.5M NaCl, 10mM imidazole, pH 8.0) at a ratio of 1:10 (m / v), and the ultrasonic cell disruptor (Ningbo Xinzhi Biotechnology Co., Ltd.) to destroy bacteria, the ultrasonic condition is 60% power, the total time is 15min, 3 times, each time is 5s, and the interval is 5s. After breaking the bacteria, centrifuge at 12,000 rpm for 30 minutes to collect the supernatant, and filter it with a 0.45 μm filter membrane.

[0102] 2) Purification by affinity chromatography column Ni Sepharose 6 Fast Flow.

[0103] The Ni column was pre-equilibrated with binding buffer. After loading, the unbound impurities were sequentially eluted with 10 times column volume of binding buffer, and 6 times column volume of washing buffer (binding buffer containing 50mM imidazole). For weakly bound foreign proteins, u...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a human tumor necrosis factor-alpha (hTNF-alpha) mutant protein, and discloses the characteristic of generating or enhancing the immune response aiming at TNF-alpha molecules in an organism. With a genetic code expansion technology, a non-natural amino acid p-nitrophenylalanine (pNO2Phe) is introduced to the 11 and / or 87 locus in hTNF-alpha, such that hTNF-alpha mutant protein is obtained. Through immunizing animals, the mutant protein can stimulate an organism to produce cross antibodies to react with the disease-related natural inflammatory factor TNF-alpha, such that the immune tolerance of hTNF-alpha as an autologous protein vaccine is broken through. Compared with prototype hTNF-alpha and a single-locus mutant, the immunogenicity of the two-locus mutant protein is enhanced. The mutant protein can be used as a candidate molecule for treating autoimmune diseases.

Description

technical field [0001] The invention belongs to the fields of biopharmaceuticals and immunology, and relates to the preparation of hTNF-α mutant protein containing unnatural amino acid p-nitrophenylalanine, which can break autoimmune tolerance and enhance hTNF-α immunogen Sex, stimulate the body to produce cross-antibodies, and become candidate vaccine molecules for the treatment of autoimmune diseases. Background technique [0002] TNF-α is a cytokine with complex biological activities. However, when TNF-α is overexpressed, it will cause pathological damage together with other inflammatory factors, such as autoimmune diseases, dyscrasias and infectious diseases. Therefore, neutralizing the overexpressed TNF-α in vivo can treat the above diseases. TNF-α antagonists currently used clinically include TNF-α monoclonal antibodies and TNF-α soluble receptors, but these drugs have disadvantages such as large dosage, easy to cause hypersensitivity reactions, and long-term repeate...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/525C12N15/28A61K39/00A61P37/04
Inventor高向东田浤陈斗姚文兵宋潇达
OwnerCHINA PHARM UNIV