Molecular marker and application of rice blast-resistant gene Pik

A rice blast and molecular marker technology, applied in the field of plant biology, can solve problems such as good resistance, achieve moderate amplification of fragments, improve breeding efficiency, and meet the effects of large-scale molecular breeding

Inactive Publication Date: 2015-07-22
SOUTH CHINA AGRI UNIV
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

although Pik The resistance spectra of different resistance multip

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker and application of rice blast-resistant gene Pik
  • Molecular marker and application of rice blast-resistant gene Pik
  • Molecular marker and application of rice blast-resistant gene Pik

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 Rice Pik Primer Design and Amplified Fragment Analysis of Gene Functional Marker Pik-C / T

[0032] 1. Primer design

[0033] multiple alleles of resistance Pik-H4 Through multiple sequence alignment with LOC_Os11g46210, it was found that the multiple alleles of resistance and Nipponbare pik There is a SNP variation at base 2173, in which the resistance gene is T and the susceptible gene is C. Design functional markers Pik-C / T covering differential sites. The Pik-C / T is composed of 4 primers Pik-T-F, Pik-C-R, Pik-O-F and Pik-O-R, and the primer sequences (5'-3') are as follows:

[0034]Pik-T-F: TCTCCGTGAGGTGCATCTCAAAGTT C GT

[0035] Pik-C-R: AACTTGGTTATTGCTTCTGCCCCA G CG

[0036] Pik-O-F: GCAATGCCAGCACTCGAAATCATTGAAA

[0037] Pik-O-R: TGATAGAGGGGCAGCATCAGATGATTGG

[0038] (The underlined bases in the primer sequence are the introduced mismatched bases, and the framed bases are the variant bases to be detected)

[0039] 2. Anal...

Embodiment 2

[0041] Example 2 Rice Pik Identification of 7 Rice Disease Resistance Genotypes by Gene Functional Marker Pik-C / T

[0042] 1. Extraction of rice genomic DNA

[0043] Seven rice varieties were used as materials: Huazhan, Yuefeng Xinzhan, H4 aggregation line "H436", H4, Hanghui 1173, Huazhan / H4 aggregation line, Yuefeng Xinzhan / H4 aggregation line. Select the young leaves of a single rice plant, and use the CTAB method to extract rice genomic DNA. The specific steps are as follows: (1) Take an appropriate amount of fresh leaves and put them in a 2 mL centrifuge tube and add liquid nitrogen to mash them. Add 1 mL of CTAB extract to the centrifuge tube. , shake well; (2) Place in a water bath or incubator at 65°C, shake gently every 10 minutes, take it out after 30-45 minutes; (3) After cooling for 2 minutes, add chloroform-isoamyl alcohol (24:1 ) until the tube is full, shake vigorously up and down to mix the two evenly; (4) put the centrifuge tube into a centrifuge at 15...

Embodiment 3

[0058] Example 3 Application of functional marker Pik-C / T to identify individual rice plants

[0059] 1. Test materials: H4 aggregation line "H436" was used as the donor parent, Yuefeng Xinzhan was used as the recurrent parent, and the BC produced was backcrossed 1 f 2 The isolated individual plants improved by backcrossing were used as test materials.

[0060] 2. Extraction of rice genomic DNA: same as Example 2.

[0061] 3. Amplification of functional marker Pik-C / T: same as in Example 2.

[0062] 4. Capillary electrophoresis detection and genotype determination of amplified products

[0063] The capillary electrophoresis detection method of the amplified product is as described in Example 2, and the genotype is determined:

[0064] The amplified products are two fragments of 260 bp and 131 bp, showing that the genotype of the marker individual is C / C homozygous ( image 3 1st to 2nd, 4th, 6th, 9th, and 11th detection samples); the amplified products w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of plant biology, and particularly discloses a molecular marker and application of a rice blast-resistant gene Pik. The molecular marker comprises a pair of outer primers Pik-O-F and Pik-O-R as well as a pair of inner primers Pik-T-F and Pik-C-R, and primer sequences are shown as SEQ ID NO: 1 to 4. When the molecular marker is used for identifying the genotype of the rice blast-resistant gene Pik, sequencing is not required, and only through simple PCR, genotyping can be performed on the rice blast-resistant gene to distinguish rice blast-resistant rice varieties from rice blast-susceptible varieties, so that molecular marker assistant selection of rice blast is achieved; the molecular marker can improve the detection efficiency of the Pik gene, is applicable to the molecular marker assistant selection of a rice improvement segregation population, can improve the breeding efficiency, and meets the requirement for large-scale molecular breeding.

Description

technical field [0001] The invention belongs to the field of plant biotechnology, in particular to a rice blast resistance gene Pik molecular markers and their applications. Background technique [0002] Rice is an important crop in my country, and the stability of its output is directly related to the national economy and people's livelihood. Rice blast is a devastating disease of rice, which has a major impact on rice yield. Rice with high blast resistance has always been the key target for breeding new rice varieties. At present, discovering broad-spectrum rice blast resistance genes or major QTLs, and cultivating rice varieties with broad-spectrum and long-lasting disease resistance through aggregate breeding are the main measures to control rice blast. Therefore, the detection of rice blast resistance genes and the screening of blast resistance rice germplasm are particularly important. The traditional detection of rice blast resistance is identified by manually cut...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895
Inventor 郭涛肖武名陈立凯黄翠红罗文龙陈志强王慧
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap