Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Molecular marker for rice aroma gene and application thereof

A fragrance gene and molecular marker technology, applied in the field of plant biology, can solve the problem of less obvious polymorphism differences, and achieve the effects of improving breeding efficiency, strong specificity, and moderate marker amplification fragments.

Inactive Publication Date: 2015-07-22
SOUTH CHINA AGRI UNIV
View PDF4 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] against badh2-E7 Alleles, Molecular markers such as Indel have been applied to genotyping at present, due to the less obvious differences in polymorphisms, there are certain limitations in its application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker for rice aroma gene and application thereof
  • Molecular marker for rice aroma gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Rice badh2-E7 Primer design for the allelic functional marker badh2-E7-FM

[0033] 1. Primer design

[0034] Aroma gene in rice badh2 Comparing the sequences of scented and non-scented alleles in different rice varieties, it was analyzed that there was an 8bp deletion and 3bp variation in exon 7 of the coding region, and a functional marker covering the difference was designed badh2 - E7 -FM ( figure 1 ). said badh2 - E7 -FM consists of 4 primers Badh2-WT-F, Badh2-E7-R, Badh2-O-F and Badh2-O-R, and the primer sequences (5'-3') are as follows:

[0035] Badh2-WT-F: GGGAGTTATGAAACTGGTAAAAAGA

[0036] Badh2-E7-R: aaccataggagcagctgaaata

[0037] Badh2-O-F: cttccttcaggtgtgctaaaca

[0038] Badh2-O-R: GAATGATGCTCCAAAGTGTCTTGA

[0039] (The framed bases in the primer sequence are allelic variant bases)

[0040] 2. Analysis of expected amplified fragments

[0041] Using the above four primers for rice badh2 Genes were amplified, with aroma allele...

Embodiment 2

[0042] Example 2 uses badh2-E7 -FM Molecular Marker Identification of Aroma Genotypes in Five Rice Varieties

[0043] 1. Extraction of rice genomic DNA

[0044] Five rice varieties were used as materials: Huazhan / Basmati370, Huazhan, Nipponbare, Basmati370 and Ivory Xiangzhan. Select the young leaves of a single rice plant, and use the CTAB method to extract rice genomic DNA. The specific steps are as follows: (1) Take an appropriate amount of fresh leaves and put them in a 2 mL centrifuge tube and add liquid nitrogen to mash them. Add 1 mL of CTAB extract to the centrifuge tube. , shake well; (2) Place in a water bath or incubator at 65°C, shake gently every 10 minutes, take it out after 30-45 minutes; (3) After cooling for 2 minutes, add chloroform-isoamyl alcohol (24:1 ) until the tube is full, shake vigorously up and down to mix the two evenly; (4) put the centrifuge tube into a centrifuge at 15,000 r / min for 10 min and take it out; (5) carefully pipette the supernata...

Embodiment 3

[0054] Example 3 Application of badh2-E7-FM to identify individual rice plants

[0055] 1. Testing materials: Using the rice variety Huazhan as the reincarnation parent and Basmati370 as the donor parent, use backcrossing technology to introduce aroma genes into the Huazhan genetic background, backcross BC 1 f 2 10 individual plants of rice were used as test materials.

[0056] 2. Extraction of rice genomic DNA: same as Example 2.

[0057] 3. Functional mark badh2-E7 -FM amplification: same as Example 2.

[0058] 4. Polyacrylamide gel electrophoresis detection and genotype determination of the amplified product: same as Example 2, the results are as follows:

[0059] The amplified products are two fragments of 368 bp and 188 bp, showing that the genotype of the marker individual is the non-scent allele ( Badh2 - WT homozygous, figure 2 The 6th to 11th and 14th detection samples in the sample); the amplified products were three fragments of 360 bp (368 bp existed ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of plant biology, and particularly discloses a molecular marker for a rice aroma gene and application thereof. The molecular marker consists of a pair of outer primers Badh2-O-F and Badh2-O-R and a pair of inner primers Badh2-WT-F and Badh2-E7-R, wherein the primer sequences are shown as SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4; an amplified fragment of the marker is moderate and is high in specificity; the rice gelatinization temperature control gene badh2-E7 can be genotyped into aroma rice and aroma-free rice varieties; auxiliary selection of the molecular marker of the rice aroma characteristics can be realized by utilizing the marker; the breeding efficiency is improved; the requirement on large-scale molecular breeding is met.

Description

technical field [0001] The invention belongs to the field of plant biotechnology, and more specifically relates to a molecular marker and application of a rice fragrance gene. Background technique [0002] Rice is an important crop in my country, and fragrance is an important characteristic of high-quality rice. Fragrant rice is loved by people because of its excellent fragrance quality, and occupies an important position in the international rice market. Research on rice fragrance traits and fragrant rice breeding is also increasing. be valued. Selecting aromatic rice is one of the most important links in breeding. The traditional selection method for aromatic rice breeding is to indirectly select the aroma genotype or aroma rice through phenotype. This method has long cycle, low efficiency, poor accuracy, etc. shortcoming. The most effective selection should be to directly select the aroma genotype, and the identification of aroma function genes and the appearance of func...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q2600/13
Inventor 郭涛陈立凯周丹华黄翠红罗文龙陈志强王慧
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com