Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for identifying purity of hybrid seed by rapidly extracting eggplant single seed DNA

A technology for the purity and identification method of hybrids, applied in the field of biological breeding, can solve the problems of purity identification of hybrids, high protein and impurity content, and inability to see DNA bands, etc., so as to shorten the grinding time, fully extract and save energy. The effect of human and material resources

Inactive Publication Date: 2015-08-12
TIANJIN KERNEL VEGETABLE RES INST
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Liu Jun used the NaOH cracking method to extract DNA from eggplant seed shoots for variety purity identification. The extracted DNA contained high levels of protein and impurities, and no obvious DNA bands could be seen by agarose electrophoresis, and there were 2%- 4% of the samples could not be amplified normally, resulting in missing bands, and it took at least 5-7 days for the eggplant to germinate
After searching, there is no report on the rapid identification of the purity of hybrids by extracting DNA from a single eggplant seed.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for identifying purity of hybrid seed by rapidly extracting eggplant single seed DNA
  • Method for identifying purity of hybrid seed by rapidly extracting eggplant single seed DNA
  • Method for identifying purity of hybrid seed by rapidly extracting eggplant single seed DNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Rapid Extraction of DNA from Single Seed of Eggplant Hybrid Yuanfengyuan for Variety Purity Identification

[0030] DNA extraction

[0031] 1. Take 1 seed each of the female parent and the male parent of the eggplant variety Yuanfengyuan to be tested, F 1 100 seeds were put into 2ml round-bottomed centrifuge tubes with two 2mm diameter steel balls placed in advance, placed in three batches in a 48-hole tray of a high-throughput tissue grinder, and ground at a frequency of 65Hz for 70s to form a uniform powder, which is very suitable for Rapid extraction of large batches of DNA samples. Add 600uL 65°C preheated 2×CTAB extraction buffer (including 0.1% mercaptoethanol) to each centrifuge tube with a continuous sampler, place it in a centrifuge tube rack and place it in a water bath at 65°C for 30 minutes, and mix every 5 minutes. Even once. After 30 minutes, the centrifuge tube was taken out and placed in a high-speed centrifuge, and the parameters were set at 12000 rp...

Embodiment 2

[0068] The single seed DNA of eggplant hybrid 46-2012 was rapidly extracted for variety purity identification, the method was the same as in Example 1, the primers used were changed to SSR150,

[0069] Forward primer is ACAACATTTCTAAGGG CCTTCACG,

[0070] Reverse primer is GTTTGGGCATATTTGGCACTTGTTGAAT,

[0071] Synthesized by Shanghai Sangong.

[0072] Analysis of results: see figure 2 . A total of 178 samples were extracted, 23 were lost, 131 samples were amplified, and 111 readable bands were obtained, including 7 female-type and 104 heterozygous. Purity: 104 / 111=93.7%.

Embodiment 3

[0074] Rapid extraction of DNA from a single seed of the eggplant hybrid Zishuai No. 4 was used for variety purity identification. The method was the same as in Example 1, and the primers used were changed to SSR150.

[0075] Forward primer is ACAACATTTCTAAGGG CCTTCACG,

[0076] Reverse primer is GTTTGGGCATATTTGGCACTTGTTGAAT,

[0077] Synthesized by Shanghai Sangong.

[0078] Result analysis: A total of 120 samples were extracted, 4 samples were lost, 116 samples were amplified, and 110 readable bands were obtained. It can be seen from the figure that the male parent of the 9-1 population has a male parent x in addition to No. 8. Among them, the offspring produced by parent 7 and 8 accounted for 54.5% of the total = 60 / 110; the offspring produced by parent 7 and x accounted for 42.7% of the total = 47 / 110; the offspring of the female parent's genotype accounted for 1.8% of the total = 2 / 110 ; The offspring of the paternal genotype accounted for 0.9%=1 / 110 of the total, a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for identifying purity of a hybrid seed by rapidly extracting an eggplant single seed DNA. The method comprises the following steps: getting one particle of the homozygous parental seeds to be tested, 100 particles of the hybrid seeds F1 generation and extracting DNA of a single seed; respectively filling each seed into 2mL of a round head centrifuging tube, putting two steel balls with the diameter of 2 mm into the round head centrifuging tube, and performing liquid nitrogen quick freezing for 30 seconds; smashing by a high-flux tissue grinder with the frequency of 65 Hz and the time of 70s; and sufficiently extracting the DNA by adding the sodium acetate, increasing the reverse blending times and improving the centrifuging time and the rotary speed. The method is simple and rapid, the seed cannot be processed and the requirement of identifying the purity of variety through an SSR method can be met by extracting the DNA. The identifying method provided by the invention has the characteristics of rapid detection speed, low cost and reliable result.

Description

technical field [0001] The invention belongs to the technical field of biological breeding, and in particular relates to a new method for rapidly extracting DNA from a single eggplant seed and using it for hybrid purity identification. Background technique [0002] Compared with conventional varieties, eggplant hybrids have many advantages such as high yield, stress resistance and high quality. However, eggplant is a strictly self-pollinated crop. In the process of hybrid seed production, due to untimely or incomplete castration, self-seeds are often produced, causing losses to production. Therefore, timely detection of hybrid purity is very important. Currently, the main methods are: [0003] Field testing: This method is currently used by most eggplant seed production units. Eggplant seedlings are 50-60 days old, harvested 40-50 days after planting, and the entire identification period is more than 100 days, which takes a long time. After the identification results are...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/10C12Q1/68
Inventor 王利英石瑶乔军李素文王立宾郑华森
Owner TIANJIN KERNEL VEGETABLE RES INST