Method for identifying purity of hybrid seed by rapidly extracting eggplant single seed DNA
A technology for the purity and identification method of hybrids, applied in the field of biological breeding, can solve the problems of purity identification of hybrids, high protein and impurity content, and inability to see DNA bands, etc., so as to shorten the grinding time, fully extract and save energy. The effect of human and material resources
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Rapid Extraction of DNA from Single Seed of Eggplant Hybrid Yuanfengyuan for Variety Purity Identification
[0030] DNA extraction
[0031] 1. Take 1 seed each of the female parent and the male parent of the eggplant variety Yuanfengyuan to be tested, F 1 100 seeds were put into 2ml round-bottomed centrifuge tubes with two 2mm diameter steel balls placed in advance, placed in three batches in a 48-hole tray of a high-throughput tissue grinder, and ground at a frequency of 65Hz for 70s to form a uniform powder, which is very suitable for Rapid extraction of large batches of DNA samples. Add 600uL 65°C preheated 2×CTAB extraction buffer (including 0.1% mercaptoethanol) to each centrifuge tube with a continuous sampler, place it in a centrifuge tube rack and place it in a water bath at 65°C for 30 minutes, and mix every 5 minutes. Even once. After 30 minutes, the centrifuge tube was taken out and placed in a high-speed centrifuge, and the parameters were set at 12000 rp...
Embodiment 2
[0068] The single seed DNA of eggplant hybrid 46-2012 was rapidly extracted for variety purity identification, the method was the same as in Example 1, the primers used were changed to SSR150,
[0069] Forward primer is ACAACATTTCTAAGGG CCTTCACG,
[0070] Reverse primer is GTTTGGGCATATTTGGCACTTGTTGAAT,
[0071] Synthesized by Shanghai Sangong.
[0072] Analysis of results: see figure 2 . A total of 178 samples were extracted, 23 were lost, 131 samples were amplified, and 111 readable bands were obtained, including 7 female-type and 104 heterozygous. Purity: 104 / 111=93.7%.
Embodiment 3
[0074] Rapid extraction of DNA from a single seed of the eggplant hybrid Zishuai No. 4 was used for variety purity identification. The method was the same as in Example 1, and the primers used were changed to SSR150.
[0075] Forward primer is ACAACATTTCTAAGGG CCTTCACG,
[0076] Reverse primer is GTTTGGGCATATTTGGCACTTGTTGAAT,
[0077] Synthesized by Shanghai Sangong.
[0078] Result analysis: A total of 120 samples were extracted, 4 samples were lost, 116 samples were amplified, and 110 readable bands were obtained. It can be seen from the figure that the male parent of the 9-1 population has a male parent x in addition to No. 8. Among them, the offspring produced by parent 7 and 8 accounted for 54.5% of the total = 60 / 110; the offspring produced by parent 7 and x accounted for 42.7% of the total = 47 / 110; the offspring of the female parent's genotype accounted for 1.8% of the total = 2 / 110 ; The offspring of the paternal genotype accounted for 0.9%=1 / 110 of the total, a...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap