A site-mutated Deinococcus thermophilic Irre protein and its application
A technology of Deinococcus thermophiles and proteins, applied in the field of IrrE protein of Deinococcus thermophiles, can solve problems such as the analysis of key functional motifs that have not been seen
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1 Expression of Deinococcus thermophilic Dgeo0395 gene sequence in Escherichia coli
[0043] 1. Experimental method
[0044]1. Design 1 pair of PCR-specific primers according to the Dgeo0395 gene sequence in the published Deinococcus thermophilic strain DSM 11300 genome:
[0045] 0395-F: 5′ACCACTAGT ATGACGCAGGGCCAGACCCC 3′
[0046] 0395-R: 5′ACCCATATG TCAGACACCCGACTCATCCT 3′
[0047] 2. The target gene sequence was amplified from the genomic DNA of Deinococcus thermophilic strain DSM 11300 by PCR method.
[0048] Reaction conditions: 94°C for 10 min, 35 cycles of [94°C for 30 sec, 60°C for 30 sec, 72°C for 1.5 min], 72°C for 10 min.
[0049] 3. After the PCR product was recovered by gel, it was cloned on the vector pJET, named pJET-0395, and verified by sequencing; then the Dgeo0395 gene containing cohesive ends and the pRADZ3 vector containing the groEL promoter were obtained by SpeI / NdeI double digestion, and the The Dgeo0395 gene was connected to the pRAD...
Embodiment 2
[0053] Example 2 Stress resistance experiment of recombinant engineered strains containing Deinococcus thermophilic strain Dgeo0395
[0054] 1. Experimental materials
[0055] Recombinant engineering strain: the JM-0395 strain containing Deinococcus thermophilic strain Dgeo0395 obtained in Example 1
[0056] Control strain: the JM-Z3 strain containing the empty plasmid described in Example 1.
[0057] 2. Experimental method
[0058] 1. Streak activation of the control strain and the recombinant engineering strain on the LB solid medium plate;
[0059] 2. Pick a single colony and inoculate it in liquid LB medium supplemented with corresponding antibiotics, and cultivate it at 37°C until the middle and late stages of the index;
[0060] 3. Centrifuge at 6,000 rpm for 5 minutes at room temperature to collect the bacteria, then wash the bacteria twice with the same volume of phosphate buffer (pH 7.0), and shake evenly;
[0061] Next, UV radiation resistance, mitomycin C resist...
Embodiment 3
[0092] Example 3 Amino Acid Optimization Sequence Construction of the Functional Domain Motif of Deinococcus Thermophilic Dgeo0395 Gene
[0093] According to the homologous gene sequence comparison analysis data, the amino acid sequence of the important functional domain motif 154LAELAR159 of the protein expressed by Deinococcus thermophila Dgeo0395 was optimized.
[0094] 1. Experimental method
[0095] Amino acid optimization was carried out on the important functional domain motif 154LAELAR159 of the regulatory protein Dgeo0395 of Deinococcus thermophila. The domains of regulatory protein Dgeo0395 were analyzed by homology modeling. Dgeo0395 consists of three structural domains, among which the HTH domain is involved in the binding of the target gene promoter. Its HTH domain is composed of three α-helices (α6, α7 and α8), and the α7 helix contains an important functional domain motif 154LAELA159. At present, a total of 23 sequences of homologous proteins of Dgeo0395 have...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More