Two plant eIF4A genes and application thereof in preparation of transgenic rice stripe virus resistant plant body
A rice streak virus, transgenic technology, applied in plant genetic improvement, angiosperms/flowering plants, botanical equipment and methods, etc., can solve problems such as plant dwarfing, plant leaf shrinkage, etc., to avoid virus diseases, obviously safe sexual effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Example 1 turn NbeIF4A Acquisition of Nicotiana benthamiana and Analysis of RSV Inoculation
[0020] The tobacco variety transferred in the present invention is Nicotiana benthamiana.
[0021] 1. Acquisition of Recombinant Agrobacterium
[0022] 1) Cloning of NbeIF4A
[0023] Utilizing primers ATGGCAGGCTTGGCACCAGA and TCAAAGGAGATCAGCAACATT, using Nicotiana benthamiana cDNA as a template, it was amplified by common PCR. The cDNA of Nicotiana benthamiana was reversed from the total RNA extracted by the Trizol method. The reverse system and conditions are as follows:
[0024]
[0025] First, add the first four reagents to the RNase-free micro-volume EP tube, mix well, and denature at 70°C for 5 minutes; immediately put it on ice and let it stand for 2 minutes. Then add the latter three reagents one by one, mix well and invert in the PCR instrument according to the following conditions.
[0026] 42°C 59min
[0027] 42°...
Embodiment 2
[0055] Example 2 turn OseIF4A Analysis of Rice Acquisition and RSV Inoculation
[0056] The rice variety transferred in the present invention is Nipponbare.
[0057] 1. Acquisition of Recombinant Agrobacterium
[0058] 1) OseIF4A clone
[0059] Using primers ATGGCGGGAATGGCACCAG and TCACAGAAGGTCAGCGACGT, rice cDNA was used as a template to amplify by common PCR. The cDNA synthesis and PCR reaction conditions of rice were the same as those in Example 1.
[0060] 2) Vector construction
[0061] Using the primers CTCTAGAATGGCGGGAATGGCACCAG (the underline indicates the XbaI restriction site) and CGTCGACTCACAGAAGGTCAGCGACGT (the underline indicates the SalI restriction site), and using the full length of OseIF4A obtained above as a template, amplify OseIF4A containing the restriction site under the same conditions as above The sequence was inserted into the multiple cloning site of the binary expression vector pCV1300 by conventional enzyme cutting and ligation. The const...
Embodiment 3
[0085] Example 3 Transmutation of the binding site OseIF4A Gene( OseIF4Am ) rice acquisition and analysis of RSV inoculation
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com