Supercharge Your Innovation With Domain-Expert AI Agents!

Two plant eIF4A genes and application thereof in preparation of transgenic rice stripe virus resistant plant body

A rice streak virus, transgenic technology, applied in plant genetic improvement, angiosperms/flowering plants, botanical equipment and methods, etc., can solve problems such as plant dwarfing, plant leaf shrinkage, etc., to avoid virus diseases, obviously safe sexual effect

Inactive Publication Date: 2015-09-02
ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
View PDF3 Cites 28 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the analysis found that the down-regulation of the gene expression in Nicotiana benthamiana led to shrunken leaves and dwarfed plants.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Two plant eIF4A genes and application thereof in preparation of transgenic rice stripe virus resistant plant body
  • Two plant eIF4A genes and application thereof in preparation of transgenic rice stripe virus resistant plant body
  • Two plant eIF4A genes and application thereof in preparation of transgenic rice stripe virus resistant plant body

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1 turn NbeIF4A Acquisition of Nicotiana benthamiana and Analysis of RSV Inoculation

[0020] The tobacco variety transferred in the present invention is Nicotiana benthamiana.

[0021] 1. Acquisition of Recombinant Agrobacterium

[0022] 1) Cloning of NbeIF4A

[0023] Utilizing primers ATGGCAGGCTTGGCACCAGA and TCAAAGGAGATCAGCAACATT, using Nicotiana benthamiana cDNA as a template, it was amplified by common PCR. The cDNA of Nicotiana benthamiana was reversed from the total RNA extracted by the Trizol method. The reverse system and conditions are as follows:

[0024]

[0025] First, add the first four reagents to the RNase-free micro-volume EP tube, mix well, and denature at 70°C for 5 minutes; immediately put it on ice and let it stand for 2 minutes. Then add the latter three reagents one by one, mix well and invert in the PCR instrument according to the following conditions.

[0026] 42°C 59min

[0027] 42°...

Embodiment 2

[0055] Example 2 turn OseIF4A Analysis of Rice Acquisition and RSV Inoculation

[0056] The rice variety transferred in the present invention is Nipponbare.

[0057] 1. Acquisition of Recombinant Agrobacterium

[0058] 1) OseIF4A clone

[0059] Using primers ATGGCGGGAATGGCACCAG and TCACAGAAGGTCAGCGACGT, rice cDNA was used as a template to amplify by common PCR. The cDNA synthesis and PCR reaction conditions of rice were the same as those in Example 1.

[0060] 2) Vector construction

[0061] Using the primers CTCTAGAATGGCGGGAATGGCACCAG (the underline indicates the XbaI restriction site) and CGTCGACTCACAGAAGGTCAGCGACGT (the underline indicates the SalI restriction site), and using the full length of OseIF4A obtained above as a template, amplify OseIF4A containing the restriction site under the same conditions as above The sequence was inserted into the multiple cloning site of the binary expression vector pCV1300 by conventional enzyme cutting and ligation. The const...

Embodiment 3

[0085] Example 3 Transmutation of the binding site OseIF4A Gene( OseIF4Am ) rice acquisition and analysis of RSV inoculation

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an application of plant eIF4A genes in preparation of rice stripe virus infection resistant rice. According to the invention, a binary expression vector is constructed by utilizing the plant eIF4A genes and vsiRNA binding site mutants thereof; rice and nicotiana benthamiana are successfully converted; and a rice stripe virus infection resistant transgenic plant is obtained. Experimental results show that the tolerance of the plant body to rice stripe virus can be obtained through expression of the plant eIF4A genes or the vsiRNA binding site mutants thereof in the plant body.

Description

technical field [0001] The invention relates to the field of genetic engineering technology and the field of plant disease prevention and control, in particular to plant eIF4A Applications of genes in plant tolerance to rice stripe virus (RSV) disease. Background technique [0002] RSV is an important rice virus transmitted by the small planthopper. The rice stripe blight caused by the virus continues to occur in my country, causing serious economic losses. In recent years, Chinese scientists have carried out a series of meticulous and in-depth work on the biology and molecular biology of RSV: the whole genome sequence of the virus has been determined, the virus silencing suppressor protein and motor protein have been identified, and the rice interaction protein has been isolated. Screening work, establishment of SBPH feeding poison, detection technology, comprehensive control technology and other work, the progress made in these work has deepened people's understanding of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12N15/84A01H5/00
Inventor 燕飞林林周红施冰斌郑红英鲁宇文赵晋平陈剑平
Owner ZHEJIANG ACADEMY OF AGRICULTURE SCIENCES
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More